Anatomy & Physiology
1st Edition
ISBN: 9781938168130
Author: Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher: OpenStax College
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 6, Problem 50CTQ
During the early years of space exploration our astronauts, who had been floating in space, would return to earth showing significant bone loss dependent on how long they were in space. Discuss how this might happen and what could be done to alleviate this condition.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 6 Solutions
Anatomy & Physiology
Ch. 6 - Which function of the skeletal system would be...Ch. 6 - Bone tissue can be described as ________. dead...Ch. 6 - Without red marrow, bones would not be able to...Ch. 6 - Yellow marrow has been identified as ________. an...Ch. 6 - Which of the following can be found in areas of...Ch. 6 - The skeletal system is made of ________. a....Ch. 6 - Most of the bones of the arms and hands are long...Ch. 6 - Sesamoid bones are found embedded in ________....Ch. 6 - Bones that surround the spinal cord are classified...Ch. 6 - Which category of bone is among the most numerous...
Ch. 6 - Long bones enable body movement by acting as a...Ch. 6 - Which of the following occurs in the spongy bone...Ch. 6 - The diaphysis contains ________. a. the metaphysis...Ch. 6 - The fibrous membrane covering the outer surface of...Ch. 6 - Which of the following are incapable of undergoing...Ch. 6 - Which cells do not originate from osteogenic...Ch. 6 - Which of the following are found in compact bone...Ch. 6 - Which of the following are only found in...Ch. 6 - The area of a bone where the nutrient foramen...Ch. 6 - Why is cartilage slow to heal? because it...Ch. 6 - Why are osteocytes spread out in bone tissue? They...Ch. 6 - In endochondral ossification, what happens to the...Ch. 6 - Which of the following bones is (are) formed by...Ch. 6 - Bones grow in length due to activity in the...Ch. 6 - Bones grow in diameter due to bone formation...Ch. 6 - Which of the following represents the correct...Ch. 6 - A fracture can be both ________. open and closed...Ch. 6 - How can a fractured diapliysis release fat...Ch. 6 - In a compound fracture, ________. the break occurs...Ch. 6 - The internal and external calli are replaced by...Ch. 6 - The first type of bone to form during fracture...Ch. 6 - Wolffs Law, which describes the effect of...Ch. 6 - Calcium cannot be absorbed from the small...Ch. 6 - Which one of the following foods is best for bone...Ch. 6 - Which of the following hormones are responsible...Ch. 6 - With respect to their direct effects on osseous...Ch. 6 - When calcium levels are too high or too low, which...Ch. 6 - All of the following play a role in calcium...Ch. 6 - Which of the following is most likely to be...Ch. 6 - The skeletal system is composed of bone and...Ch. 6 - What are the structural and functional differences...Ch. 6 - What are the structural and functional differences...Ch. 6 - If the articular cartilage at the end of one of...Ch. 6 - In what ways is the structural makeup of compact...Ch. 6 - In what ways do intramembranous and endochondral...Ch. 6 - Considering how a long bone develops, what are the...Ch. 6 - What is the difference between closed reduction...Ch. 6 - In terms of origin and composition, what are the...Ch. 6 - If you were a dietician who had a young female...Ch. 6 - During the early years of space exploration our...Ch. 6 - An individual with very low levels of vitamin D...Ch. 6 - Describe the effects caused when the parathyroid...
Additional Science Textbook Solutions
Find more solutions based on key concepts
The central nervous system is responsible for: a. integrative functions. b. sensory functions. c. motor functio...
Human Anatomy & Physiology (2nd Edition)
1. Why is the quantum-mechanical model of the atom important for understanding chemistry?
Chemistry: Structure and Properties (2nd Edition)
For parts a, b, and c, draw a diagram illustrating the alleleson homologous chromosomes for the following genot...
Genetic Analysis: An Integrated Approach (3rd Edition)
Which type of cartilage is most plentiful in the adult body?
Anatomy & Physiology (6th Edition)
Explain the role of gene flow in the biological species concept.
Campbell Biology (11th Edition)
Name the components (including muscles) of the thoracic cage. List the contents of the thorax.
Human Physiology: An Integrated Approach (8th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
GCSE PE - ANTAGONISTIC MUSCLE ACTION - Anatomy and Physiology (Skeletal and Muscular System - 1.5); Author: igpe_complete;https://www.youtube.com/watch?v=6hm_9jQRoO4;License: Standard Youtube License