Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 4.3, Problem 2MQ
- To which end (5′ or 3′) of a newly synthesized strand of DNA does DNA polymerase add a
nucleotide ?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What chemical group (phosphate group, hydroxyl group, or anitrogenous base) is found at the 3′ end of a DNA strand? Whatgroup is found at the 5′ end?
in the DNA of certain bacterial cells, 13% of the nucleotides are adenine. What are the percentages of the other nucleotides?
To which end (5′ or 3′) of a newly synthesized strand of DNAdoes DNA polymerase add a nucleotide?
Chapter 4 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 4.1 - What is a genome and what is it composed of? What...Ch. 4.1 - Define the terms complementary and antiparallel as...Ch. 4.1 - Why is supercoiling essential to a bacterial cell?...Ch. 4.1 - Describe the central dogma of molecular biology....Ch. 4.2 - Approximately how large is the Escherichia coli...Ch. 4.2 - Prob. 2MQCh. 4.2 - Prob. 3MQCh. 4.2 - Prob. 1CRCh. 4.3 - Prob. 1MQCh. 4.3 - To which end (5 or 3) of a newly synthesized...
Ch. 4.3 - Prob. 3MQCh. 4.3 - What are the functions of DNA Pol I and III and...Ch. 4.3 - What is meant by the term semiconservative...Ch. 4.4 - Prob. 1MQCh. 4.4 - Prob. 2MQCh. 4.4 - Prob. 3MQCh. 4.4 - Prob. 1CRCh. 4.5 - What enzyme catalyzes transcription? What is a...Ch. 4.5 - Prob. 2MQCh. 4.5 - Prob. 3MQCh. 4.5 - Prob. 4MQCh. 4.5 - Prob. 1CRCh. 4.6 - What three major components make up an archaeal...Ch. 4.6 - Prob. 2MQCh. 4.6 - Prob. 3MQCh. 4.6 - How does the archaeal RNA polymerase differ from...Ch. 4.7 - Prob. 1MQCh. 4.7 - Differentiate between the different classes of...Ch. 4.7 - Prob. 3MQCh. 4.7 - Describe the two types of secondary structure a...Ch. 4.8 - Prob. 1MQCh. 4.8 - What is the function of the acceptor stem of a...Ch. 4.8 - Prob. 3MQCh. 4.8 - Prob. 1CRCh. 4.9 - Prob. 1MQCh. 4.9 - Prob. 2MQCh. 4.9 - Prob. 3MQCh. 4.9 - Why is the genetic code a degenerate code? What is...Ch. 4.10 - What are the components of a ribosome? What...Ch. 4.10 - How is a completed polypeptide chain released from...Ch. 4.10 - How does tmRNA free stalled ribosomes?Ch. 4.10 - Where on the ribosome do tRNAs bind, and what is...Ch. 4.11 - What are molecular chaperones and why are they...Ch. 4.11 - What macromolecules are protected by heat shock...Ch. 4.11 - How do chaperones assist the Escherichia coli cell...Ch. 4.11 - What proteins are involved in refolding misfolded...Ch. 4.12 - Prob. 1MQCh. 4.12 - Prob. 2MQCh. 4.12 - Prob. 3MQCh. 4.12 - Prob. 1CRCh. 4.13 - Prob. 1MQCh. 4.13 - Prob. 2MQCh. 4.13 - Prob. 3MQCh. 4.13 - Prob. 1CRCh. 4 - The genome of the bacterium Neisseria gonorrhoeae...Ch. 4 - Compare and contrast the activity of DNA and RNA...Ch. 4 - What would be the result (in terms of protein...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How many kilobases of the DNA strand below will code for the protein product?arrow_forwardWhat sequence of bases on one strand of DNA (reading in the 3′ to 5′ direction) is complementary to the sequence 5′ T-A-T-G-C-A-G 3′ on the other strand?arrow_forwardWhat statement about DNA polarity is TRUE? One end of the chain has a 5'-OH group attached to a phosphoryl group. The other end of the chain has a free 3'-OH group, which is linked to another nucleotide. One end of the chain has a free 5'-OH group or 5'-OH group attached to a phosphoryl group. The other end of the chain has a free 3'-OH group. None is linked to another nucleotide. One end of the chain has a free 3'-OH group or 3'-OH group attached to a phosphoryl group. The other end of the chain has a free 3'-OH group, which is linked to another nucleotide. One end of the chain has only a free 5'-OH group. The other end of the chain has a free 3'-OH group. Neither is linked to another nucleotide. One end of the chain has a free 5'-OH group. The other end of the chain has a free 3'-OH group.arrow_forward
- Spontaneous deamination of cytosine bases in DNA takes place at low but measurable frequency. Cytosine is converted into uracil by loss of its amino group. After this conversion, which base pair occupies this position in each of the daughter strands resulting from one round of replication? Two rounds of replication? (a) How many different 8-mer sequences of DNA are there? (Hint: There are 16 possible dinucleotides and 64 possible trinucleotides.) We can quantify the information- carrying capacity of nucleic acids in the following way. Each position can be one of four bases, corresponding to two bits of information (2² = 4). Thus, a chain of 5100 nucleotides corresponds to 2 × 5100 = 10,200 bits, or 1275 bytes (1 byte =8 bits). (b) How many bits of information are stored in an 8-mer DNA sequence? In the E. coli genome? In the human genome? (c) Compare each of these values with the amount of information that can be stored on a computer compact disc, or CD (about 700 megabytes).arrow_forwardWhat is the name of the enzyme that add nucleotides to a growing DNA strand? What kind of bonds does this enzyme form between the nucleotides?arrow_forwardIn NOT more than 200 words, explain how the double-helical structure of DNA suggests a mechanism for DNA replication?arrow_forward
- Why does DNA replication produce two daughter strands that are identical to each other and to the parent DNA?arrow_forwardWhat is the axial ratio (length:diameter) of a DNA molecule 20 μm long?arrow_forwardHow important and useful to the cell is the ability of the DNA to assume various forms? Why are these various forms necessary?arrow_forward
- Telomerase is a reverse transcriptase enzyme that carries its own RNA molecule (Figure 1(a)). The telomerase enzyme attaches to the end of the telomeric region (Figure 1(b)) for DNA replication. (i) Indicate by drawing where the RNA of Telomerase binds to the telomeric region. W, X, Y, and Z are the ends of the DNA and RNA strands respectively. Identify ends of DNA's X, Y, and Z shown in Figure 1(a) & (b). (ii) (a) Telomerase -AAUCCCAAU- ITTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' ПAАTСССААТСССААТСССАА-Х (b) Telomeric DNA Figure 1arrow_forwardA DNA strand has the following sequence: 5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′In which direction would DNA polymerase slide along this strand(from left to right or from right to left)? If this strand was used as atemplate by DNA polymerase, what would be the sequence of thenewly made strand? Indicate the 5′ and 3′ ends of the newly madestrand.arrow_forwardA DNA strand was sequenced using the Sanger method (https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction tube contained the DNA strand, fluorescently labelled dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green, ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA polymerase, or its Klenow fragment. Synthesis of DNA is allowed to proceed, and the results are shown on the right: 15 14 13 12 11 10 (a) What is the sequence of the copy and the template strands? (b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy? Nucleotide Lengtharrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license