Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 4.7, Problem 3MQ
Summary Introduction
Replication, transcription, and translation are important processes of the central dogma of biology. The synthesis of the protein from the mRNA sequence in the cytoplasm is known as translation. Three major components are involved in protein synthesis are mRNA, tRNA and ribosomes. Protein plays an important role in the structure and function of cells.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
Chapter 4 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 4.1 - What is a genome and what is it composed of? What...Ch. 4.1 - Define the terms complementary and antiparallel as...Ch. 4.1 - Why is supercoiling essential to a bacterial cell?...Ch. 4.1 - Describe the central dogma of molecular biology....Ch. 4.2 - Approximately how large is the Escherichia coli...Ch. 4.2 - Prob. 2MQCh. 4.2 - Prob. 3MQCh. 4.2 - Prob. 1CRCh. 4.3 - Prob. 1MQCh. 4.3 - To which end (5 or 3) of a newly synthesized...
Ch. 4.3 - Prob. 3MQCh. 4.3 - What are the functions of DNA Pol I and III and...Ch. 4.3 - What is meant by the term semiconservative...Ch. 4.4 - Prob. 1MQCh. 4.4 - Prob. 2MQCh. 4.4 - Prob. 3MQCh. 4.4 - Prob. 1CRCh. 4.5 - What enzyme catalyzes transcription? What is a...Ch. 4.5 - Prob. 2MQCh. 4.5 - Prob. 3MQCh. 4.5 - Prob. 4MQCh. 4.5 - Prob. 1CRCh. 4.6 - What three major components make up an archaeal...Ch. 4.6 - Prob. 2MQCh. 4.6 - Prob. 3MQCh. 4.6 - How does the archaeal RNA polymerase differ from...Ch. 4.7 - Prob. 1MQCh. 4.7 - Differentiate between the different classes of...Ch. 4.7 - Prob. 3MQCh. 4.7 - Describe the two types of secondary structure a...Ch. 4.8 - Prob. 1MQCh. 4.8 - What is the function of the acceptor stem of a...Ch. 4.8 - Prob. 3MQCh. 4.8 - Prob. 1CRCh. 4.9 - Prob. 1MQCh. 4.9 - Prob. 2MQCh. 4.9 - Prob. 3MQCh. 4.9 - Why is the genetic code a degenerate code? What is...Ch. 4.10 - What are the components of a ribosome? What...Ch. 4.10 - How is a completed polypeptide chain released from...Ch. 4.10 - How does tmRNA free stalled ribosomes?Ch. 4.10 - Where on the ribosome do tRNAs bind, and what is...Ch. 4.11 - What are molecular chaperones and why are they...Ch. 4.11 - What macromolecules are protected by heat shock...Ch. 4.11 - How do chaperones assist the Escherichia coli cell...Ch. 4.11 - What proteins are involved in refolding misfolded...Ch. 4.12 - Prob. 1MQCh. 4.12 - Prob. 2MQCh. 4.12 - Prob. 3MQCh. 4.12 - Prob. 1CRCh. 4.13 - Prob. 1MQCh. 4.13 - Prob. 2MQCh. 4.13 - Prob. 3MQCh. 4.13 - Prob. 1CRCh. 4 - The genome of the bacterium Neisseria gonorrhoeae...Ch. 4 - Compare and contrast the activity of DNA and RNA...Ch. 4 - What would be the result (in terms of protein...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage LearningEssentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage
Cell Differentiation | Genetics | Biology | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=gwAz_BtVuLA;License: Standard YouTube License, CC-BY