
General, Organic, and Biological Chemistry
7th Edition
ISBN: 9781285853918
Author: H. Stephen Stoker
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 4.2, Problem 2QQ
Interpretation Introduction
Interpretation:
Identification of the number of valence electrons present in an atom with the electron configuration
Concept Introduction:
The electrons present in the outermost shell of the atom are known as valence electrons.
Valence electrons are important because:
- The valence electrons decide the reactivity of an element.
- The valence electrons decide the way an atom forms a bond with another atom.
- The valence electron in an atom decides the combining capacity of the element.
- Except inner
transition elements valence electrons are present in s or p subshells of elements. - For inner transition elements incompletely filled d or f subshells electrons are considered as valence electrons.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
7. Aerobic respiration of a protein that breaks down into 12 molecules of malic acid. Assume there is no
other carbon source and no acetyl-CoA.
NADH
FADH2
OP ATP
SLP ATP
Total ATP
Show your work using dimensional analysis here:
3
For each of the following problems calculate the following: (Week 6-3 Video with 6-1 and 6-2)
Consult the total catabolic pathways on the last page as a reference for the following questions.
A. How much NADH and FADH2 is produced and fed into the electron transport chain (If any)?
B. How much ATP is made from oxidative phosphorylation (OP), if any? Feed the NADH and FADH2 into the
electron transport chain: 3ATP/NADH, 2ATP/FADH2
C. How much ATP is made by substrate level phosphorylation (SLP)?
D. How much total ATP is made? Add the SLP and OP together.
1. Aerobic respiration using 0.5 mole of glucose?
NADH
FADH2
OP ATP
SLP ATP
Total ATP
Show your work using dimensional analysis here:
Aerobic respiration of one lipid molecule. The lipid is composed of one glycerol molecule connected to two
fatty acid tails. One fatty acid is 12 carbons long and the other fatty acid is 18 carbons long in the figure
below. Use the information below to determine how much ATP will be produced from the glycerol part of
the lipid. Then, in part B, determine how much ATP is produced from the 2 fatty acids of the lipid. Finally
put the NADH and ATP yields together from the glycerol and fatty acids (part A and B) to determine your
total number of ATP produced per lipid. Assume no other carbon source is available.
18 carbons
fatty acids
12 carbons
glycerol
. Glycerol is broken down to glyceraldehyde 3-phosphate, a glycolysis intermediate via the following
pathway shown in the figure below. Notice this process costs one ATP but generates one FADH2. Continue
generating ATP with glyceraldehyde-3-phosphate using the standard pathway and aerobic respiration.
glycerol
glycerol-3-
phosphate…
Chapter 4 Solutions
General, Organic, and Biological Chemistry
Ch. 4.1 - Prob. 1QQCh. 4.1 - Prob. 2QQCh. 4.1 - Prob. 3QQCh. 4.2 - How many valence electrons are present in an atom...Ch. 4.2 - Prob. 2QQCh. 4.2 - Prob. 3QQCh. 4.2 - Prob. 4QQCh. 4.2 - Which of the following elements would have the...Ch. 4.3 - Prob. 1QQCh. 4.3 - Prob. 2QQ
Ch. 4.3 - Prob. 3QQCh. 4.4 - In terms of subatomic particles, a Ca2+ ion...Ch. 4.4 - Prob. 2QQCh. 4.4 - Prob. 3QQCh. 4.4 - Prob. 4QQCh. 4.5 - An atom with a 1s22s22p4 electron configuration...Ch. 4.5 - Prob. 2QQCh. 4.5 - Prob. 3QQCh. 4.5 - Prob. 4QQCh. 4.5 - Prob. 5QQCh. 4.6 - Prob. 1QQCh. 4.6 - Prob. 2QQCh. 4.6 - Prob. 3QQCh. 4.7 - What is the chemical formula of the ionic compound...Ch. 4.7 - What is the chemical formula of the ionic compound...Ch. 4.7 - Given that Z2 ions are present in the ionic...Ch. 4.7 - Prob. 4QQCh. 4.8 - Prob. 1QQCh. 4.8 - Which of the following is a correct description of...Ch. 4.9 - Prob. 1QQCh. 4.9 - Prob. 2QQCh. 4.9 - Prob. 3QQCh. 4.9 - Prob. 4QQCh. 4.9 - Prob. 5QQCh. 4.9 - Prob. 6QQCh. 4.9 - The correct name for the binary ionic compound...Ch. 4.9 - Prob. 8QQCh. 4.10 - Prob. 1QQCh. 4.10 - Which of the following statements about polyatomic...Ch. 4.10 - The nitrate, sulfate, and phosphate ions have,...Ch. 4.10 - Prob. 4QQCh. 4.11 - Prob. 1QQCh. 4.11 - Prob. 2QQCh. 4.11 - Prob. 3QQCh. 4.11 - Prob. 4QQCh. 4.11 - Prob. 5QQCh. 4.11 - What is the chemical formula for the compound...Ch. 4 - Contrast the two general types of chemical bonds...Ch. 4 - Contrast the two general types of chemical...Ch. 4 - How many valence electrons do atoms with the...Ch. 4 - How many valence electrons do atoms with the...Ch. 4 - Prob. 4.5EPCh. 4 - Prob. 4.6EPCh. 4 - Write the complete electron configuration for each...Ch. 4 - Write the complete electron configuration for each...Ch. 4 - Prob. 4.9EPCh. 4 - For each of the following pairs of representative...Ch. 4 - How many of the highlighted elements in the...Ch. 4 - How many of the highlighted elements in the...Ch. 4 - Draw Lewis symbols for atoms of each of the...Ch. 4 - Draw Lewis symbols for atoms of each of the...Ch. 4 - Each of the following Lewis symbols represents a...Ch. 4 - Each of the following Lewis symbols represents a...Ch. 4 - Prob. 4.17EPCh. 4 - Prob. 4.18EPCh. 4 - What is the chemical property of the noble gases...Ch. 4 - Prob. 4.20EPCh. 4 - Prob. 4.21EPCh. 4 - Prob. 4.22EPCh. 4 - Give the chemical symbol for each of the following...Ch. 4 - Give the chemical symbol for each of the following...Ch. 4 - What would be the chemical symbol for an ion with...Ch. 4 - What would be the chemical symbol for an ion with...Ch. 4 - Fill in the blanks in each line in the following...Ch. 4 - Fill in the blanks in each line in the following...Ch. 4 - Fill in the blanks in each line of the following...Ch. 4 - Fill in the blanks in each line of the following...Ch. 4 - Identify element X by giving its chemical symbol,...Ch. 4 - Prob. 4.32EPCh. 4 - Prob. 4.33EPCh. 4 - Prob. 4.34EPCh. 4 - Prob. 4.35EPCh. 4 - Draw Lewis symbols for the following ions. a. O2...Ch. 4 - What is the charge on the monatomic ion formed by...Ch. 4 - What is the charge on the monatomic ion formed by...Ch. 4 - Indicate the number of electrons lost or gained...Ch. 4 - Indicate the number of electrons lost or gained...Ch. 4 - Which noble gas has an electron configuration...Ch. 4 - Prob. 4.42EPCh. 4 - Which noble gas is isoelectronic with each of the...Ch. 4 - Which noble gas is isoelectronic with each of the...Ch. 4 - Prob. 4.45EPCh. 4 - Indicate whether or not each of the following...Ch. 4 - Prob. 4.47EPCh. 4 - Prob. 4.48EPCh. 4 - Prob. 4.49EPCh. 4 - Write the electron configuration of the following....Ch. 4 - How many valence electrons are present in each of...Ch. 4 - Prob. 4.52EPCh. 4 - Using Lewis structures, show how ionic compounds...Ch. 4 - Using Lewis structures, show how ionic compounds...Ch. 4 - The following Lewis symbols for ions have the...Ch. 4 - Prob. 4.56EPCh. 4 - Prob. 4.57EPCh. 4 - Prob. 4.58EPCh. 4 - Prob. 4.59EPCh. 4 - Prob. 4.60EPCh. 4 - The component elements for four binary ionic...Ch. 4 - Prob. 4.62EPCh. 4 - Write the complete chemical formula (symbol and...Ch. 4 - Write the complete chemical formula (symbol and...Ch. 4 - Write the chemical formula for the ionic compound...Ch. 4 - Prob. 4.66EPCh. 4 - Prob. 4.67EPCh. 4 - What is the chemical formula of the ionic compound...Ch. 4 - A representative element (X) forms an ion with a 2...Ch. 4 - A representative element (Z) forms an ion with a...Ch. 4 - Prob. 4.71EPCh. 4 - The following questions pertain to the ionic...Ch. 4 - Prob. 4.73EPCh. 4 - Prob. 4.74EPCh. 4 - Prob. 4.75EPCh. 4 - Prob. 4.76EPCh. 4 - Prob. 4.77EPCh. 4 - Prob. 4.78EPCh. 4 - Prob. 4.79EPCh. 4 - Which of the following binary compounds would be...Ch. 4 - Name the following binary ionic compounds, each of...Ch. 4 - Name the following binary ionic compounds, each of...Ch. 4 - Calculate the charge on the metal ion in the...Ch. 4 - Calculate the charge on the metal ion in the...Ch. 4 - Prob. 4.85EPCh. 4 - Prob. 4.86EPCh. 4 - Prob. 4.87EPCh. 4 - Prob. 4.88EPCh. 4 - Name each of the following binary ionic compounds....Ch. 4 - Name each of the following binary ionic compounds....Ch. 4 - Prob. 4.91EPCh. 4 - Name each compound in the following pairs of...Ch. 4 - Prob. 4.93EPCh. 4 - Write chemical formulas for the following binary...Ch. 4 - Prob. 4.95EPCh. 4 - Write chemical formulas for the following binary...Ch. 4 - Prob. 4.97EPCh. 4 - Prob. 4.98EPCh. 4 - Fill in the blanks in each line of the following...Ch. 4 - Prob. 4.100EPCh. 4 - Prob. 4.101EPCh. 4 - Prob. 4.102EPCh. 4 - Prob. 4.103EPCh. 4 - How many oxygen atoms are present in each of the...Ch. 4 - Prob. 4.105EPCh. 4 - Prob. 4.106EPCh. 4 - Prob. 4.107EPCh. 4 - Prob. 4.108EPCh. 4 - Prob. 4.109EPCh. 4 - Prob. 4.110EPCh. 4 - How many ions are present per formula unit in each...Ch. 4 - Prob. 4.112EPCh. 4 - Name the following compounds, all of which contain...Ch. 4 - Prob. 4.114EPCh. 4 - Prob. 4.115EPCh. 4 - Prob. 4.116EPCh. 4 - Prob. 4.117EPCh. 4 - Write formulas for the following compounds, all of...Ch. 4 - Write chemical formulas for the following...Ch. 4 - Write chemical formulas for the following...Ch. 4 - Prob. 4.121EPCh. 4 - Prob. 4.122EPCh. 4 - Prob. 4.123EPCh. 4 - Prob. 4.124EP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, chemistry and related others by exploring similar questions and additional content below.Similar questions
- Don't copy the other answerarrow_forward4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is equivalent to acetyl-CoA. NADH FADH2 OP ATP SLP ATP Total ATP Show your work using dimensional analysis here: 5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source. NADH FADH2 OP ATP Show your work using dimensional analysis here: SLP ATP Total ATParrow_forwardBiology You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?arrow_forward
- Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.arrow_forwardAwnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forwardAnwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forward
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning


Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Mass Spectrometry; Author: Professor Dave Explains;https://www.youtube.com/watch?v=hSirWciIvSg;License: Standard YouTube License, CC-BY