
Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 3, Problem 21CTQ
Why are biological macromolecules considered organic?
Expert Solution & Answer

Trending nowThis is a popular solution!

Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 3 Solutions
Biology 2e
Ch. 3 - Figure 3.5 What kind of sugars are these, aldose...Ch. 3 - Figure 3.23 Which categories of amino acid would...Ch. 3 - Figure 3.33 A mutation occurs, and cytosine is...Ch. 3 - Dehydration synthesis leads to formation of...Ch. 3 - During the breakdown of polymers, which of the...Ch. 3 - The following chemical reactants produce the ester...Ch. 3 - An example of a monosaccharide is fructose glucose...Ch. 3 - Cellulose and starch are examples of:...Ch. 3 - Plant cell walls contain which of the following in...Ch. 3 - Lactose is a disaccharide formed by the formation...
Ch. 3 - Which of the following is not an extracellular...Ch. 3 - Saturated fats have all of the following...Ch. 3 - Phospholipids are important components of...Ch. 3 - Cholesterol is an integral part of plasma...Ch. 3 - The monomers that make up proteins are called...Ch. 3 - The helix and the pleated sheet are part of...Ch. 3 - Mad cow disease is an infectious disease where one...Ch. 3 - A nucleotide of DNA may contain. ribose, uracil,...Ch. 3 - The building blocks of nucleic acids are ____. a....Ch. 3 - How does the double helix structure of DNA support...Ch. 3 - Why are biological macromolecules considered...Ch. 3 - What role do electrons play in dehydration...Ch. 3 - Amino acids have the generic structure seen below,...Ch. 3 - Describe the similarities and differences between...Ch. 3 - Why is it impossible for humans to digest food...Ch. 3 - Draw the ketose and aldose forms of a...Ch. 3 - Explain at least three functions that lipids serve...Ch. 3 - Why have trans fats been banned from some...Ch. 3 - Why are fatty acids better than glycogen for...Ch. 3 - Part of cortisol’s role in the body involves...Ch. 3 - Explain what happens if even one amino acid is...Ch. 3 - Describe the differences in the four protein...Ch. 3 - Aquaporins are proteins embedded in the plasma...Ch. 3 - What are the structural differences between RNA...Ch. 3 - What are the four types of RNA and how do they...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Identify me theme or themes exemplified by (a) the sharp quills of a porcupine (b) the development of a multice...
Campbell Biology in Focus (2nd Edition)
You have isolated (1) a streptomycin-resistant mutant (strR) of Chlamydomonas that maps to the chloroplast geno...
Genetic Analysis: An Integrated Approach (3rd Edition)
16. Explain some of the reasons why the human species has been able to expand in number and distribution to a g...
Campbell Biology: Concepts & Connections (9th Edition)
Q1. What is the empirical formula of a compound with the molecular formula
Chemistry: A Molecular Approach (4th Edition)
Assume that genes, A and B are on the same chromosome and are 50 map units apart. An animal heterozygous at bot...
Campbell Biology (11th Edition)
2. Define equilibrium population. Outline the conditions that must be met for a population to stay in genetic e...
Biology: Life on Earth (11th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
GCSE Chemistry - Acids and Bases #34; Author: Cognito;https://www.youtube.com/watch?v=vt8fB3MFzLk;License: Standard youtube license