Fundamentals of General, Organic, and Biological Chemistry (8th Edition)
8th Edition
ISBN: 9780134015187
Author: John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 27, Problem 27.17AP
Interpretation Introduction
Interpretation:
The number of base pairs in the human genome working drafts has to be identified.
Concept Introduction:
Human Genome:
In humans, the whole set of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'TGCGTGTGTGC3' and its complement, how many copies of this sequence are present in the bandicoot genome?
Assume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to sequence a human genome. Suppose the length of the human genome is 3x109 bps. What is the depth (i.e., coverage) of the sequencing?
Consider the following distance matrix:
A
B
C
D
A
B C D
☆
0.1
0.4 0.3
0.8 0.6 0.2
Using the UPGMA algorithm, answer the following questions:
a) What two sequences are the most related? Which are the least related?
b) Does the following tree accurately capture the relationship among the sequ
in the distance matrix (ignoring branch lengths)? Explain in detail why or why
Chapter 27 Solutions
Fundamentals of General, Organic, and Biological Chemistry (8th Edition)
Ch. 27.1 - Decode the following sequence of letters to find...Ch. 27.3 - Prob. 27.1CIAPCh. 27.3 - Prob. 27.2CIAPCh. 27.3 - Prob. 27.3CIAPCh. 27.3 - Prob. 27.2KCPCh. 27.4 - Prob. 27.3PCh. 27.4 - A restriction enzyme known as EcoRI cuts DNA in...Ch. 27.4 - Prob. 27.5PCh. 27.5 - Classify the following activities according to the...Ch. 27.5 - Prob. 27.4CIAP
Ch. 27.5 - Prob. 27.5CIAPCh. 27.5 - Prob. 27.6CIAPCh. 27 - What steps are necessary in the mapping of the...Ch. 27 - Prob. 27.8UKCCh. 27 - List the four types of noncoding DNA (see Section...Ch. 27 - In general, what are the differences between...Ch. 27 - What is recombinant DNA? How can it be used to...Ch. 27 - Identify some major potential benefits of the...Ch. 27 - Prob. 27.13APCh. 27 - Prob. 27.14APCh. 27 - Prob. 27.15APCh. 27 - Prob. 27.16APCh. 27 - Prob. 27.17APCh. 27 - Prob. 27.18APCh. 27 - Prob. 27.19APCh. 27 - You may have heard of Dolly, the cloned sheep...Ch. 27 - Prob. 27.21APCh. 27 - Prob. 27.22APCh. 27 - What is the role of the enzyme telomerase? In what...Ch. 27 - Prob. 27.24APCh. 27 - Prob. 27.25APCh. 27 - Prob. 27.26APCh. 27 - Prob. 27.27APCh. 27 - What is a SNP?Ch. 27 - How are SNPs linked to traits in individual human...Ch. 27 - List some potential biological effects of SNPs.Ch. 27 - Prob. 27.31APCh. 27 - Prob. 27.32APCh. 27 - Prob. 27.33APCh. 27 - Prob. 27.34APCh. 27 - Prob. 27.35APCh. 27 - Prob. 27.36APCh. 27 - Prob. 27.37APCh. 27 - Prob. 27.38APCh. 27 - In the formation of recombinant DNA. a restriction...Ch. 27 - Give the sequence of unpaired bases that would be...Ch. 27 - Are the following base sequences sticky or not...Ch. 27 - Prob. 27.42APCh. 27 - Prob. 27.43APCh. 27 - Provide two examples of genetically engineered...Ch. 27 - Prob. 27.45APCh. 27 - Why is the field of bioethics so important in...Ch. 27 - Prob. 27.47CPCh. 27 - Prob. 27.48CPCh. 27 - Prob. 27.49CPCh. 27 - Prob. 27.50CPCh. 27 - What is a restriction endonuclease?Ch. 27 - Prob. 27.52CPCh. 27 - Prob. 27.53GPCh. 27 - One of the most actively pursued areas in genomics...Ch. 27 - Prob. 27.55GP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- The human genome is approximately 3 billion basepairs in size.a. Using standard 8.5″ × 11″ paper with one-inch margins, a 12-point font size, and single-spaced lines, howmany sheets of paper printed on one side would berequired to print out the human genome?b. A ream of 500 sheets of paper is about 5 cm thick.How tall would the stack of paper with the entirehuman genome be?c. Would you want a backpack, shopping cart, or asemitrailer truck to haul around this stack?arrow_forwardPedigree Analysis Is a Basic Method in Human Genetic: What does OMIM stand for? What kinds of information are in this database?arrow_forwardApproximately what portion of the human genome is composed of repeat sequences?arrow_forward
- What proportion of exons are repeated sequences in the human genome? Is 38% surprising?arrow_forwardHow were the specific sequences of triplet codes determined experimentally?arrow_forwardIn addition to the standard base-paired helical structures, DNA can form X-shaped hairpin structures called cruciforms in which most bases are involved in Watson–Crick pairs. Such structures tend to occur at sequences with inverted repeats. Draw the cruciform structure formed by the DNA sequence TCAAGTCCACGGTGGACTTGC.arrow_forward
- Approximately how many Okazaki fragments are synthesized in thereplication of the human genome?arrow_forwardCalculate the number of Alu elements present in the haploid human genome based on the number of Alu elements present in the clones analysed by the entire class. You will need to know the total length of DNA analysed and the number of Alu elements present. For the entire class, 57 Alu elements are present in 174,204 bp.arrow_forwardSuppose you are comparing two sequences that are 100 bases long. To calculate the percent similarity (also referred to as percent identity) between the two sequences, you simply count the total number of bases that are identical between the two sequences and divide that value by 100. For example, if two sequences that are 100 bases long have 80 80 bases in common, the percent similarity would be 80% ( 100 x 100). Now practice with three shorter sequences. The following sequences are from three related organisms: Organism A: TGGCATTCAT Organism B: TCGAATACGA Organism C: TGCCTTACAT Drag the terms on the left to the appropriate blanks on the right to answer the questions. Not all terms will be used. Reset Help 30% What is the percent similarity between organisms A and B? 40% What is the percent similarity between organisms A and C?arrow_forward
- The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…arrow_forwardWhat does massively parallel sequencing mean?arrow_forwardBased on the question,give an asnwer Question : Name the scoring matrix “A”. List the advantage(s) of this scoring matrix.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license