Fundamentals of General, Organic, and Biological Chemistry (8th Edition)
8th Edition
ISBN: 9780134015187
Author: John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 27, Problem 27.49CP
Interpretation Introduction
Interpretation:
The base sequence which would be sticky with the given sequence should be written.
Concept Introduction:
A base is nitrogen containing heterocyclic compound which is found in DNA and RNA.
There are mainly four nitrogen bases found in DNA and they are,
- (1) Adenine
- (2) Guanine
- (3) Cytosine
- (4) Thymine
Short stretches of single stranded DNA are sticky (complementary) to each other. If both ends are cut with the same enzyme, the sticky ends will stick together by complementary base pairing, forming hydrogen bonds.
In DNA, Adenine always makes a double bond with thymine (
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Draw each of the following base pairs: A-T, G-C, and U-A
Which of the following sequences is less
favorable to find in a folded beta?
Select one:
a.l-V-A-I-G-P-L-A-V-F-Y
b. G-A-L-V-F-C-V-I-L-L-P
c. E-V-A-I-I-F-M-D-G-V-A
d. A-V-G-I-L-P-L-A-V-F-Y
e.A-A-V-L-L-A-I-G-L-M-W
Translate this nucleotide sequence into an amino acid sequence.
Gene Sequence (5'-to-3'):…
Chapter 27 Solutions
Fundamentals of General, Organic, and Biological Chemistry (8th Edition)
Ch. 27.1 - Decode the following sequence of letters to find...Ch. 27.3 - Prob. 27.1CIAPCh. 27.3 - Prob. 27.2CIAPCh. 27.3 - Prob. 27.3CIAPCh. 27.3 - Prob. 27.2KCPCh. 27.4 - Prob. 27.3PCh. 27.4 - A restriction enzyme known as EcoRI cuts DNA in...Ch. 27.4 - Prob. 27.5PCh. 27.5 - Classify the following activities according to the...Ch. 27.5 - Prob. 27.4CIAP
Ch. 27.5 - Prob. 27.5CIAPCh. 27.5 - Prob. 27.6CIAPCh. 27 - What steps are necessary in the mapping of the...Ch. 27 - Prob. 27.8UKCCh. 27 - List the four types of noncoding DNA (see Section...Ch. 27 - In general, what are the differences between...Ch. 27 - What is recombinant DNA? How can it be used to...Ch. 27 - Identify some major potential benefits of the...Ch. 27 - Prob. 27.13APCh. 27 - Prob. 27.14APCh. 27 - Prob. 27.15APCh. 27 - Prob. 27.16APCh. 27 - Prob. 27.17APCh. 27 - Prob. 27.18APCh. 27 - Prob. 27.19APCh. 27 - You may have heard of Dolly, the cloned sheep...Ch. 27 - Prob. 27.21APCh. 27 - Prob. 27.22APCh. 27 - What is the role of the enzyme telomerase? In what...Ch. 27 - Prob. 27.24APCh. 27 - Prob. 27.25APCh. 27 - Prob. 27.26APCh. 27 - Prob. 27.27APCh. 27 - What is a SNP?Ch. 27 - How are SNPs linked to traits in individual human...Ch. 27 - List some potential biological effects of SNPs.Ch. 27 - Prob. 27.31APCh. 27 - Prob. 27.32APCh. 27 - Prob. 27.33APCh. 27 - Prob. 27.34APCh. 27 - Prob. 27.35APCh. 27 - Prob. 27.36APCh. 27 - Prob. 27.37APCh. 27 - Prob. 27.38APCh. 27 - In the formation of recombinant DNA. a restriction...Ch. 27 - Give the sequence of unpaired bases that would be...Ch. 27 - Are the following base sequences sticky or not...Ch. 27 - Prob. 27.42APCh. 27 - Prob. 27.43APCh. 27 - Provide two examples of genetically engineered...Ch. 27 - Prob. 27.45APCh. 27 - Why is the field of bioethics so important in...Ch. 27 - Prob. 27.47CPCh. 27 - Prob. 27.48CPCh. 27 - Prob. 27.49CPCh. 27 - Prob. 27.50CPCh. 27 - What is a restriction endonuclease?Ch. 27 - Prob. 27.52CPCh. 27 - Prob. 27.53GPCh. 27 - One of the most actively pursued areas in genomics...Ch. 27 - Prob. 27.55GP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letterarrow_forwardBamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would be created by cutting the normal gene with BamHI?arrow_forwardDNA sequences have an alphabet {A,C,G,T}. How many DNA sequences of length n are there? (Two DNA sequences are the same if one is the reverse of the other).arrow_forward
- Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA TGTGCGCGCGGGGCGarrow_forwardIn the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash between each group of three bases. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGarrow_forwardSimply put, what is DFR stand for?arrow_forward
- Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OHarrow_forwardChoose all of the statements that correctly describe the base pairs drawn below. A C H H-N -H-N N-H- -N B H D موعة Rita N -H---- 2 NHN O- -H-N H -H- N- -H-N The non-Watson-Crick base pair shown in A is much less stable than the base pairs shown in B and C, because the smaller size of the two pyrimidine bases induces a distortion in the structure of the double helix that decreases the stability of the helix when compared to helices with the normal Watson-Crick base pairs. The base pair shown in B is found in BOTH DNA and RNA The base pair shown in C is found ONLY in RNA and NOT DNA The base pair seen in B is more stable than the Watson-Crick base pair shown in C partly because of a larger number of hydrogen bonds and partly because of more favourable pi-stacking interactions with adjacent base pairs.arrow_forwardDraw the following trinucleotide: pGAUarrow_forward
- How many nucleotides would be necessary to code for 10 amino acids? Please help, I am lost!arrow_forward61 identify the primer 3' 5' a 5' 3' C e f a 5' 3' 3' 5' Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a a b b e f a Save Unansweredarrow_forwardConsider the following DNA sequence: -T -- -- If RNA primase used this section of DNA to make a primer, what would be the correct sequence of base pairs (from top to bottom)? T-A-C-C-G-T-T OT-U-C-C-G-U-U OA-T-G-G-C-A-A U-A-C-C-G-U-Uarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Bacterial Endospore Formation -Biology Pundit; Author: Biology Pundit;https://www.youtube.com/watch?v=6_sinRhE8zA;License: Standard YouTube License, CC-BY
Taxonomy of Bacteria: Identification and Classification; Author: Professor Dave Explains;https://www.youtube.com/watch?v=8IJRzcPC9wg;License: Standard YouTube License, CC-BY