Concept explainers
Interpretation:
The severity of DNA mutation that produced in the given changes in mRNA codons has to be compared.
Concept Introduction:
Mutation: Mutation is the error occurred in the base sequence of a DNA which is passed along when
Codons are the sequence of three bases in mRNA that specifies the amino acid to be incorporated into a protein.
Some amino acids and their corresponding mRNA codons are listed below,
Start codon is a codon that specifies the start of RNA translation.
Stop codon is a codon that specifies the end of RNA translation. There are mainly three stop codons UGA, UAA and UAG.
Want to see the full answer?
Check out a sample textbook solutionChapter 27 Solutions
Fundamentals of General, Organic, and Biological Chemistry (8th Edition)
- Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence (REFER TO THE SUPPLEMENTAL DOCUMENT FOR GUIDANCE TO THIS QUESTION). Guanine nucleotide (G shown in red below) was deleted from the DNA sequence at the position indicated by the arrow). Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?)arrow_forwardDystrophin is mutated in the disease, causing a codon to change from GGA to UGA. What is the consequence of this change? (arrow_forwardIn your own wordsarrow_forward
- Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence (REFER TO THE SUPPLEMENTAL DOCUMENT FOR GUIDANCE TO THIS QUESTION). Adenine nucleotide (A shown in red below) was inserted into the DNA sequence at the position indicated by the arrow). Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?)arrow_forwardexplain why a mutation in the dna nucleotide sequence that corresponds to the 3rd nitrogen base in the mrna codon is not as serious as a mutation in the dna that corresponds to the first nitrogen base in the mrna codonarrow_forwardExplain the steps of RNA translation into protein. Mutations: The codon GGA encodes the amino acid glycine. Identify the type of mutation for each of the following changes (name both the type of mutation and what the new codon would produce): GGA to GGG GGA to UGA GGA to GAGA GGA to AGAarrow_forward
- Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’arrow_forwardConsider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forwardMetabolic syndrome is a genetic disorder with symptoms of hypertension, elevated blood cholesterol concentrations, and lower-than-normal blood magnesium concentrations. This syndrome is caused by a mutation in mitochondrial DNA (mtDNA) in which a thymine nucleotide is replaced by a cytosine nucleotide. Which of the following identifies the mutated mtDNA and the corresponding mRNA and tRNA produced in a person with metabolic syndrome if the normal mtDNA triplet is TCG? Select one: a. Mutated mtDNA: CCG mRNA: GGC tRNA: GGC b. Mutated mtDNA: TCG mRNA: UGC tRNA: ACG c. Mutated mtDNA: CCG mRNA: GGC tRNA: CCG d. Mutated mtDNA: TTG mRNA: AAC tRNA: UUCarrow_forward
- Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'arrow_forwardA. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon sequence AGACACUCUAUUAAA has a single base pair mutation to AGACACUCUUUUAAA. If the old protein sequence was Arg-His-Ser-Ile-Lys, what will be the new sequence encoded by the mutant gene?arrow_forwardSickle cell anemia is a widespread disease in many African countries and can be caused by a change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with the disease and a genetic fingerprint reveals the following DNA sequence for the gene: (a) (b) (c) (d) (e) Write down the mRNA sequence for the given DNA sense strand indicating the polarity. Derive the polypeptide from the mRNA molecule using the table of the genetic code (Table Q1 below) again indicating the polarity of the peptide chain. Indicate the position in the DNA molecule that could have caused the disease and write down all possible point mutations in the DNA sequence that could have caused it. [ The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write down all possible t-RNA molecules with their anti-codons that are used to polymerize the amino acid VAL. Indicate the polarity. 3'-TAC TGA GCA AGA TTA CAT ACT-5' Explain what is meant by redundancy of the genetic code.…arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning