Fundamentals of General, Organic, and Biological Chemistry (8th Edition)
Fundamentals of General, Organic, and Biological Chemistry (8th Edition)
8th Edition
ISBN: 9780134015187
Author: John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher: PEARSON
bartleby

Videos

Question
Book Icon
Chapter 27.4, Problem 27.5P

(a)

Interpretation Introduction

Interpretation:

It should be determined that whether the given base sequences are sticky or not sticky.

Concept Introduction:

A base is nitrogen containing heterocyclic compound which is found in DNA and RNA.

There are mainly four nitrogen bases found in DNA and they are,

  1. (1) Adenine
  2. (2) Guanine
  3. (3) Cytosine
  4. (4) Thymine

Short stretches of single stranded DNA are sticky (complementary) to each other. If both ends are cut with the same enzyme, the sticky ends will stick together by complementary base pairing, forming hydrogen bonds.

In DNA, Adenine always makes a double bond with thymine (A=T) and cytosine always makes triple bond with guanine (GC)

(b)

Interpretation Introduction

Interpretation:

It should be determined that whether the given base sequences are sticky or not sticky.

Concept introduction:

A base is nitrogen containing heterocyclic compound which is found in DNA and RNA.

There are mainly four nitrogen bases found in DNA and they are,

  1. (1) Adenine
  2. (2) Guanine
  3. (3) Cytosine
  4. (4) Thymine

Short stretches of single stranded DNA are sticky (complementary) to each other. If both ends are cut with the same enzyme, the sticky ends will stick together by complementary base pairing, forming hydrogen bonds.

In DNA, Adenine always makes a double bond with thymine (A=T) and cytosine always makes triple bond with guanine (GC)

(c)

Interpretation Introduction

Interpretation:

It should be determined that whether the given base sequences are sticky or not sticky.

Concept introduction:

A base is nitrogen containing heterocyclic compound which is found in DNA and RNA.

There are mainly four nitrogen bases found in DNA and they are,

  1. (1) Adenine
  2. (2) Guanine
  3. (3) Cytosine
  4. (4) Thymine

Short stretches of single stranded DNA are sticky (complementary) to each other. If both ends are cut with the same enzyme, the sticky ends will stick together by complementary base pairing, forming hydrogen bonds.

In DNA, Adenine always makes a double bond with thymine (A=T) and cytosine always makes triple bond with guanine (GC)

Blurred answer
Students have asked these similar questions
Which of the following sequences is less favorable to find in a folded beta? Select one: a.l-V-A-I-G-P-L-A-V-F-Y b. G-A-L-V-F-C-V-I-L-L-P c. E-V-A-I-I-F-M-D-G-V-A d. A-V-G-I-L-P-L-A-V-F-Y e.A-A-V-L-L-A-I-G-L-M-W
Draw each of the following base pairs: A-T, G-C, and U-A
Each of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer 5'GCCTCCGGAGACCCATTGG 3' Reverse primer 5'TTCTAAGAAACTGTTAAGG 3' (b) Forward primer 5'GGGGCCCCTCACTCGGGGCCCC 3'Reverse primer 5'TCGGCGGCCGTGGCCGAGGCAG 3' (c) Forward primer 5'TCGAATTGCCAATGAAGGTCCG 3'Reverse primer 5'CGGACCTTCATTGGCAATTCGA 3'

Chapter 27 Solutions

Fundamentals of General, Organic, and Biological Chemistry (8th Edition)

Ch. 27.5 - Prob. 27.5CIAPCh. 27.5 - Prob. 27.6CIAPCh. 27 - What steps are necessary in the mapping of the...Ch. 27 - Prob. 27.8UKCCh. 27 - List the four types of noncoding DNA (see Section...Ch. 27 - In general, what are the differences between...Ch. 27 - What is recombinant DNA? How can it be used to...Ch. 27 - Identify some major potential benefits of the...Ch. 27 - Prob. 27.13APCh. 27 - Prob. 27.14APCh. 27 - Prob. 27.15APCh. 27 - Prob. 27.16APCh. 27 - Prob. 27.17APCh. 27 - Prob. 27.18APCh. 27 - Prob. 27.19APCh. 27 - You may have heard of Dolly, the cloned sheep...Ch. 27 - Prob. 27.21APCh. 27 - Prob. 27.22APCh. 27 - What is the role of the enzyme telomerase? In what...Ch. 27 - Prob. 27.24APCh. 27 - Prob. 27.25APCh. 27 - Prob. 27.26APCh. 27 - Prob. 27.27APCh. 27 - What is a SNP?Ch. 27 - How are SNPs linked to traits in individual human...Ch. 27 - List some potential biological effects of SNPs.Ch. 27 - Prob. 27.31APCh. 27 - Prob. 27.32APCh. 27 - Prob. 27.33APCh. 27 - Prob. 27.34APCh. 27 - Prob. 27.35APCh. 27 - Prob. 27.36APCh. 27 - Prob. 27.37APCh. 27 - Prob. 27.38APCh. 27 - In the formation of recombinant DNA. a restriction...Ch. 27 - Give the sequence of unpaired bases that would be...Ch. 27 - Are the following base sequences sticky or not...Ch. 27 - Prob. 27.42APCh. 27 - Prob. 27.43APCh. 27 - Provide two examples of genetically engineered...Ch. 27 - Prob. 27.45APCh. 27 - Why is the field of bioethics so important in...Ch. 27 - Prob. 27.47CPCh. 27 - Prob. 27.48CPCh. 27 - Prob. 27.49CPCh. 27 - Prob. 27.50CPCh. 27 - What is a restriction endonuclease?Ch. 27 - Prob. 27.52CPCh. 27 - Prob. 27.53GPCh. 27 - One of the most actively pursued areas in genomics...Ch. 27 - Prob. 27.55GP
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Biology
ISBN:9781305967359
Author:STARR
Publisher:CENGAGE L
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
DNA Use In Forensic Science; Author: DeBacco University;https://www.youtube.com/watch?v=2YIG3lUP-74;License: Standard YouTube License, CC-BY
Analysing forensic evidence | The Laboratory; Author: Wellcome Collection;https://www.youtube.com/watch?v=68Y-OamcTJ8;License: Standard YouTube License, CC-BY