
Human Anatomy
9th Edition
ISBN: 9780135168059
Author: Marieb, Elaine Nicpon, Brady, Patricia, Mallatt, Jon
Publisher: Pearson Education, Inc.,
expand_more
expand_more
format_list_bulleted
Question
Chapter 20, Problem 2CRCAQ
Summary Introduction
To review:
The more difficult and dangerous surgery on a child between closing a patent ductus arteriosus or closing a patent foramen ovale.
Introduction:
The ductus arteriosus and foramen ovale are important parts of the fetal circulatory system. During the fetal stage, there is a requirement of oxygen and nutrients for the growing embryo while dealing with the limitations of a poorly-developed pulmonary circuit at the same time. The development of these two structures helps the embryo receive blood in the fetal stage.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Chapter 20 Solutions
Human Anatomy
Ch. 20 - What structural features of capillaries make them...Ch. 20 - Prob. 2CYUCh. 20 - Prob. 3CYUCh. 20 - Prob. 4CYUCh. 20 - Prob. 5CYUCh. 20 - Prob. 6CYUCh. 20 - Which vessel do you palpate to feel a pulse in...Ch. 20 - Name the vessels that branch off the abdominal...Ch. 20 - Prob. 9CYUCh. 20 - Prob. 10CYU
Ch. 20 - Prob. 11CYUCh. 20 - Prob. 12CYUCh. 20 - How does elevated blood glucose associated with...Ch. 20 - Prob. 14CYUCh. 20 - Prob. 15CYUCh. 20 - Prob. 1RQCh. 20 - Prob. 2RQCh. 20 - Prob. 3RQCh. 20 - Prob. 4RQCh. 20 - Prob. 5RQCh. 20 - Prob. 6RQCh. 20 - Prob. 7RQCh. 20 - Prob. 8RQCh. 20 - The following sequence traces the flow of...Ch. 20 - Prob. 10RQCh. 20 - The inferior mesenteric artery supplies the (a)...Ch. 20 - Prob. 12RQCh. 20 - Prob. 13RQCh. 20 - An accident victim sustained a puncture wound in...Ch. 20 - Prob. 15RQCh. 20 - Prob. 16RQCh. 20 - (a) What structural features are responsible for...Ch. 20 - Prob. 18RQCh. 20 - Prob. 19RQCh. 20 - Sketch the arterial circle at the base of the...Ch. 20 - Prob. 21RQCh. 20 - Prob. 22RQCh. 20 - Prob. 23RQCh. 20 - Prob. 24RQCh. 20 - Differentiate between arteriosclerosis and...Ch. 20 - A pulse can be felt in the following arteries:...Ch. 20 - In an eighth-grade health class, the teacher...Ch. 20 - Prob. 2CRCAQCh. 20 - Prob. 3CRCAQCh. 20 - Prob. 4CRCAQCh. 20 - Prob. 5CRCAQCh. 20 - Prob. 6CRCAQCh. 20 - Occasionally, either the ductus arteriosus or the...Ch. 20 - Prob. 8CRCAQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Developmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Basic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:CengageSurgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:Cengage
- Essentials Health Info Management Principles/Prac...Health & NutritionISBN:9780357191651Author:BowiePublisher:Cengage
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage
Essentials Health Info Management Principles/Prac...
Health & Nutrition
ISBN:9780357191651
Author:Bowie
Publisher:Cengage
Serology 101: Testing for IgG and IgM antibodies; Author: Beckman Coulter Dx;https://www.youtube.com/watch?v=LtqKB-qpJrs;License: Standard youtube license