ACHIEVE:INTRO TO GENETIC ANALYSIS 1TERM
12th Edition
ISBN: 9781319401399
Author: Griffiths
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 2, Problem 19P
Summary Introduction
To determine: All mutations affecting the human nervous system.
Introduction: A neurological disorder is a situation in which victims undergo neurological signs like dizziness, migration complications, sensory indications, and blackouts. The brain of a patient by functional neurological symptom disorder is structurally typical, but operating inaccurately.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
If we have the following mutations, find the type of the mutation (silent or missense or nonsense?)
17C=U
36G=A
49G=U
115A=C
5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA
CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC
UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG
ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC
UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA
GGUAGAAGCCGCUGGGGCUUGGGGCU-3’
In a disorder called gyrate atrophy, cells in the retina begin to degenerate in late adolescence, causing night blindness that progresses to total blindness. The cause is a mutation in the gene that encodes an enzyme, ornithine aminotransferase (OAT). Researchers sequenced the OAT gene for 5 patients with the following results:
Patient A: A change in codon 209 of UAU to UAA
Patient B: A change in codon 299 of UAC to UAG
Patient C: A change in codon 426 of CGA to UGA
Patient D: A two-nucleotide deletion at codons 64 and 65 that results in a UGA codon at position 79.
Patient E: Exon 6, including 1071 nucleotides is entirely deleted.
Which patient(s) have a frameshift mutation?
How many amino acids is patient E missing?
Which patient(s) will produce a shortened protein?
In Figure 9-12(b), what do you think happens to the tRNA that is released from the E site?
Chapter 2 Solutions
ACHIEVE:INTRO TO GENETIC ANALYSIS 1TERM
Ch. 2 - Prob. 1PCh. 2 - Prob. 2PCh. 2 - Prob. 3PCh. 2 - Prob. 4PCh. 2 - Prob. 5PCh. 2 - Prob. 6PCh. 2 - Prob. 7PCh. 2 - Prob. 8PCh. 2 - Prob. 9PCh. 2 - Prob. 10P
Ch. 2 - Prob. 11PCh. 2 - Prob. 12PCh. 2 - Prob. 13PCh. 2 - Prob. 14PCh. 2 - Prob. 15PCh. 2 - Prob. 17PCh. 2 - Prob. 18PCh. 2 - Prob. 19PCh. 2 - Prob. 20PCh. 2 - Prob. 21PCh. 2 - Prob. 22PCh. 2 - Prob. 23PCh. 2 - Prob. 24PCh. 2 - Prob. 25PCh. 2 - Prob. 26PCh. 2 - Prob. 27PCh. 2 - Prob. 28PCh. 2 - Prob. 29PCh. 2 - Prob. 30PCh. 2 - Prob. 31PCh. 2 - Prob. 32PCh. 2 - Prob. 33PCh. 2 - Prob. 34PCh. 2 - Prob. 35PCh. 2 - Prob. 36PCh. 2 - Prob. 37PCh. 2 - Prob. 38PCh. 2 - Prob. 39PCh. 2 - Prob. 40PCh. 2 - Prob. 41PCh. 2 - Prob. 42PCh. 2 - Prob. 43PCh. 2 - Prob. 44PCh. 2 - Prob. 45PCh. 2 - Prob. 46PCh. 2 - Prob. 47PCh. 2 - Prob. 48PCh. 2 - Prob. 49PCh. 2 - Prob. 50PCh. 2 - Prob. 51PCh. 2 - Prob. 52PCh. 2 - Prob. 53PCh. 2 - Prob. 54PCh. 2 - Prob. 55PCh. 2 - Prob. 56PCh. 2 - Prob. 56.1PCh. 2 - Prob. 56.2PCh. 2 - Prob. 56.3PCh. 2 - Prob. 56.4PCh. 2 - Prob. 56.5PCh. 2 - Prob. 56.6PCh. 2 - Prob. 56.7PCh. 2 - Prob. 56.8PCh. 2 - Prob. 56.9PCh. 2 - Prob. 56.10PCh. 2 - Prob. 56.11PCh. 2 - Prob. 56.12PCh. 2 - Prob. 56.13PCh. 2 - Prob. 56.14PCh. 2 - Prob. 56.15PCh. 2 - Prob. 57PCh. 2 - Prob. 58PCh. 2 - Prob. 59PCh. 2 - Prob. 60PCh. 2 - Prob. 61PCh. 2 - Prob. 62PCh. 2 - Prob. 63PCh. 2 - Prob. 64PCh. 2 - Prob. 65PCh. 2 - Prob. 67PCh. 2 - Prob. 68PCh. 2 - Prob. 69PCh. 2 - Prob. 70PCh. 2 - Prob. 71PCh. 2 - Prob. 72PCh. 2 - Prob. 73PCh. 2 - Prob. 74PCh. 2 - Prob. 75PCh. 2 - Prob. 76PCh. 2 - Prob. 77PCh. 2 - Prob. 78PCh. 2 - Prob. 79PCh. 2 - Prob. 80PCh. 2 - Prob. 81PCh. 2 - Prob. 82PCh. 2 - Prob. 83PCh. 2 - Prob. 84PCh. 2 - Prob. 85PCh. 2 - Prob. 86PCh. 2 - Prob. 87PCh. 2 - Prob. 88PCh. 2 - Prob. 89PCh. 2 - Prob. 90PCh. 2 - Prob. 91PCh. 2 - Prob. 1GSCh. 2 - Prob. 2GSCh. 2 - Prob. 3GS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined changes to to a C the result will be - A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutation You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined is deleted, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutatio If there are 3000 bases in the coding region of a gene, the gene will have A) 3000 amino acids B) 6000 amino acids C) 1000 amino acids D) 3000 codonsarrow_forwardTwo missense mutations in the gene that encodes an enzyme called superoxide dismutase cause a form of amyotrophic lateral sclerosis (ALS, or Lou Gehrig disease). This disease causes loss of neurological function over a 5-year period. One mutation alters the amino acid asparagine (Asn) to lysine (Lys). The other changes an isoleucine (Ile) to a threonine (Thr). List the codons involved and describe how single-base mutations can alter the specified amino acids.arrow_forwardAn addition or deletion mutation that results in all of the amino acids after the mutation being wrong is calledarrow_forward
- Can someone give me a few inherited disorders that are NOT caused by mutations? and if possible, please explain/name a gene that contributes to this disorder? Thank you!arrow_forwardListed below are five amino acids. Use the genetic code to determine the exact codon for each amino acid. A point mutation at the genetic level in each codon results in the change indicated. For each mutation, indicate whether it is due to a transition or a transversion, and then indicate the effect of each mutation at the protein (amino acid level) (i.e. silent, nonsense, missense). In addition, Please note, each of the three lines above an amino acid represents a single RNA base. For example, when you look at the codon chart AUG would stand for Met (methionine) Lys 1 Glu Ile 3 Stop Ile 4.arrow_forwardThe attached table below shows the reference and a diseased patient's DMD genes in the hip flexor which, if mutated, can cause muscular dystophy. Analyze the table, make the coding strand, and explain how and which mutation in the patien's genes caused muscular dystrophyarrow_forward
- TAC/ACC/GAC/GAA/AAT/TGT/TAC/CGT/TCA/AAC asap pleasearrow_forwardConsider Molecule X, which is found in all living cells. This molecule is transcribed from a stretch of DNA in the nucleus. Each nucleobase on the DNA produces a matching nucleobase on this molecule. Every 3-base codon specifies an amino acid in a protein. What is the name of X? Your answer should be one word, or a short two- or three-word phrase. Spelling counts. Note: if there is more than one possible answer, separate each answer with a comma. x 5arrow_forwardA gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg-tyr. A mutation in this gene removes the first G in the strand.What is true of this mutation's effect on the phenotype?1.It will affect the phenotype because although most of the protein will be identical, the first amino acid will be different.2.It will not affect the phenotype because the protein will be identical to the original protein.3.It will affect the phenotype because all the amino acids past this point will be different from the original protein.4.It will not affect the phenotype because only the first amino acid is different from the original protein.arrow_forward
- A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg- tyr. A mutation in this gene has a G inserted after the second C in the strand. How will this mutation affect the phenotype? A:This will affect the phenotype because although most of the protein will be identical, the first amino acid will be different. B:This will not affect the phenotype because only the second amino acid is different from the original protein. C:This will not affect the phenotype because the protein will be identical to the original protein. D:This will affect the phenotvpe because all of the amino acids after the first one will be different from he original protein.arrow_forwardWhat is the resulting polypeptide: _______________________________________________________? What effect does this mutation have on the polypeptide? Make sure to compare to the original polypeptide. How could you have an insertion or deletion mutation that does not cause a frame shift?arrow_forwardIn the text box below, answer the following questions. Remember to label your answers that correspond to the questions, and attempt answering all of the questions to receive full credit. 1. Use the table of the genetic code to complete the following table. The columns represent transcriptional and translational alignments. Label the 5' and 3' ends of DNA and RNA, as well as the amino (N) and carboxyl (C) ends of the protein. end end DNA double G A helix 3' CA U MRNA transcribed G C A TRNA anticodon Trp Amino acidarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY