Study Guide for Campbell Biology
11th Edition
ISBN: 9780134443775
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece, Martha R. Taylor, Michael A. Pollock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 17, Problem 6IQ
In the following diagrams of polypeptide synthesis, name the stages (1–4), identify the components (a–1), and then briefly describe what happens in each stage. (This diagram does not include the initiation stage.)
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
TRUE OR FALSE
a) The structure of the purines and pyrimidines make them able to undergo keto-enol tautomerism.
b) A unique 5'CCA terminal sequence is found in all tRNAs to be able to carry the correct amino acid to the ribosome.
Original sequence:
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start):
5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’
Question:
4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this?
5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
(b)
Hemoglobin is made of B-globin subunits. The first few mRNA nucleotides for B-
globin are given by:
(1)
(iii)
(iv)
Write down the DNA sequence that has led to this mRNA and indicate the
sense and non-sense strands and the polarity.
CE
Derive the polypeptide for the sequence using the table of the genetic code
(Table Q1 below) and indicate the polarity of the polypeptide chain.
First
Position
(5' end)
U
A single point mutation in mRNA sequence can cause sickle cell anemia by
changing the amino acid Glu to Val. For the given mRNA, indicate the point
mutations for the first Glu in the polypeptide sequence that can cause this
disease.
5'-AUGGUCCACCUGACUCCUGAGGAGAAG...UGA-3'
C
The polypeptide of B-globin contains the amino acid Leu. Write down all the
anticodons of the tRNA molecules that can potentially code for Val. Indicate
the polarity of the anti-codon.
A
G
Table 1. The Codons of the Genetic Code
Second Position
U
Phe
Phe
Leu
Leu
Leu
Leu
Leu
Leu
Ile
Ile
Ile
Met-Start
Val
Val
Val…
Chapter 17 Solutions
Study Guide for Campbell Biology
Ch. 17 - a. In what three ways does RNA differ from DNA? b....Ch. 17 - Prob. 2IQCh. 17 - Prob. 3IQCh. 17 - How does the mRNA that leaves the nucleus differ...Ch. 17 - Prob. 5IQCh. 17 - In the following diagrams of polypeptide...Ch. 17 - What determines if a ribosome becomes bound to the...Ch. 17 - Define the following terms and explain what type...Ch. 17 - You have been introduced to several types of RNA...Ch. 17 - Prob. 2SYK
Ch. 17 - What is the genetic code? Explain redundancy and...Ch. 17 - Prepare a concept map showing the types and...Ch. 17 - Prob. 1TYKCh. 17 - Transcription involves the transfer of information...Ch. 17 - Prob. 3TYKCh. 17 - Prob. 4TYKCh. 17 - Which of the following is a statement of the...Ch. 17 - Prob. 6TYKCh. 17 - Prob. 7TYKCh. 17 - Prob. 8TYKCh. 17 - Which of the following is true of RNA processing?...Ch. 17 - Prob. 10TYKCh. 17 - Prob. 11TYKCh. 17 - Prob. 12TYKCh. 17 - Prob. 13TYKCh. 17 - Prob. 14TYKCh. 17 - What type of bonding is responsible for...Ch. 17 - Prob. 16TYKCh. 17 - Prob. 17TYKCh. 17 - Prob. 18TYKCh. 17 - Prob. 19TYKCh. 17 - Prob. 20TYKCh. 17 - Prob. 21TYKCh. 17 - Prob. 22TYKCh. 17 - Prob. 23TYKCh. 17 - Prob. 24TYKCh. 17 - Prob. 25TYKCh. 17 - Prob. 26TYKCh. 17 - Prob. 27TYKCh. 17 - Prob. 28TYK
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider the following in light of the concept of levels of structure (primary, secondary, tertiary, quaternary)as defined for proteins.(a) What level is shown by double-stranded DNA?(b) What level is shown by tRNA?(c) What level is shown by mRNA?arrow_forwardConsider the following in light of the concept of levels of structure (primary, secondary, tertiary, quaternary) as defined for proteins. (a) What level is shown by doublestranded DNA? (b) What level is shown by tRNA? (c) What level is shown by mRNA?arrow_forwardIn the: Inhibition of splicing by ribozymes Explain: (a) What is the process affected? (b) What is the Effect on the process? (c) Does it affect prokaryotes, eukaryotes or both?arrow_forward
- Each type of molecule listed below is recognized by a specific class of nuclear import receptor (importin) or nuclear export receptor (exportin). For each type of molecule, state whether you think it is recognized by an importin or exportin and explain why (in terms of where that molecule is synthesized, what that molecule does, and where it does it). (a) RNA polyermase II: (b) ribosomal protein: (iii) †RNA:arrow_forwardComplete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acidarrow_forwardThe following RNA sequence represents a small messenger which can be translated in a prokaryotic cell: 5'-ACGAAUGCACAGUAAAACUGGCUAGCGUAGGCUGA-3 Assume that the messenger RNA is translated in the cell, using the correct machinery and signals required for accurate protein synthesis. Using this RNA sequence and the Genetic Code Dictionary (see your textbook for the dictionary), solve the following problems A. Write the sequence of a protein that would be translated from this mRNA, using the appropriate stop and start signals, and indicating the correct termini of the protein product. B. Suppose that the underlined A in the sequence is changed to a U. Write the expected protein product of this mRNA.arrow_forward
- Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?arrow_forwardA segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)arrow_forwardProtein structure and function: a) Name two common post-translational modifications of proteins in the cell that will affect their structure/function. b) What are prions? Briefly describe their structure and function. C) Explain the principles of protein folding and significance of urea and Bmercaptoethanol in the experimental procedures addressing this question.arrow_forward
- Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forwardThe activity provides you with a version of the NGF pathway, an example of a RTK. All of the proteins involved can be in ON/OFF states. Using this cell signaling pathway you will be asked a variety of questions to determine how the molecules are regulated, but also how a cell would respond if this cell signaling party steps were interrupted or activated. Neural Growth Factir (NGF) Ras- Ras- GDP GTP Trk-A Ras-GEF braf braf МЕК МЕК ERK ERK ERK ERK STAT STAT Spiouty DNA Nucleus Cytosolarrow_forwardNonearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY