Study Guide for Campbell Biology
11th Edition
ISBN: 9780134443775
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece, Martha R. Taylor, Michael A. Pollock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 17, Problem 3TYK
Summary Introduction
Introduction: Anticodon is a triplet base sequence that is complementary to the triplet codon of an mRNA. During protein synthesis, codons of mRNA are matched with their corresponding amino acids with the help of tRNA.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene Z and the underlined and italicized sequence encodes the gene Z ribosome binding (RBS) site. Transcription begins at and includes the T/A base pair at position 60 (bold).
a. What are the nucleotides of the mRNA from gene Z?b. What are the amino acids encoded by gene Z? (A codon chart is found on the final page)
A mutation is found in a tRNA-encoding gene. The wild type (non-mutant) allele (version) produces a tRNA that recognizes the codon GAA, and is charged with the amino acid glutamic acid (Glu). The mutant tRNA is still charged with Glu, but it recognizes the codon UAA. What effect will this have on translation in these cells? How will the proteins produced be different?
Speculate: is this mutation more likely to be beneficial or harmful?
The following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene Z and the underlined and italicized sequence encodes the gene Z ribosome binding (RBS) site. Transcription begins at and includes the T/A base pair at position 60 (bold)
a. What are the nucleotides of the mRNA from gene Z?b. What are the amino acids encoded by gene Z? (A codon chart is found on the finalpage)
Chapter 17 Solutions
Study Guide for Campbell Biology
Ch. 17 - a. In what three ways does RNA differ from DNA? b....Ch. 17 - Prob. 2IQCh. 17 - Prob. 3IQCh. 17 - How does the mRNA that leaves the nucleus differ...Ch. 17 - Prob. 5IQCh. 17 - In the following diagrams of polypeptide...Ch. 17 - What determines if a ribosome becomes bound to the...Ch. 17 - Define the following terms and explain what type...Ch. 17 - You have been introduced to several types of RNA...Ch. 17 - Prob. 2SYK
Ch. 17 - What is the genetic code? Explain redundancy and...Ch. 17 - Prepare a concept map showing the types and...Ch. 17 - Prob. 1TYKCh. 17 - Transcription involves the transfer of information...Ch. 17 - Prob. 3TYKCh. 17 - Prob. 4TYKCh. 17 - Which of the following is a statement of the...Ch. 17 - Prob. 6TYKCh. 17 - Prob. 7TYKCh. 17 - Prob. 8TYKCh. 17 - Which of the following is true of RNA processing?...Ch. 17 - Prob. 10TYKCh. 17 - Prob. 11TYKCh. 17 - Prob. 12TYKCh. 17 - Prob. 13TYKCh. 17 - Prob. 14TYKCh. 17 - What type of bonding is responsible for...Ch. 17 - Prob. 16TYKCh. 17 - Prob. 17TYKCh. 17 - Prob. 18TYKCh. 17 - Prob. 19TYKCh. 17 - Prob. 20TYKCh. 17 - Prob. 21TYKCh. 17 - Prob. 22TYKCh. 17 - Prob. 23TYKCh. 17 - Prob. 24TYKCh. 17 - Prob. 25TYKCh. 17 - Prob. 26TYKCh. 17 - Prob. 27TYKCh. 17 - Prob. 28TYK
Knowledge Booster
Similar questions
- a. If a single transition occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? b. If a single transversion occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? c. If a single transition occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence? d. If a single transversion occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?arrow_forwardHemophilia in the Russian royal family was caused by defective protein involved in blood clotting (factor IX). This defective protein was caused by a mutation that altered the splicing of the exons. This genetic change in the splicing pattern created a new stop codon in the mRNA for factor IX. Give an example of how a mutation that altered the splicing sites in the pre-mRNA might lead to a premature stop codon in the gene.arrow_forwardThe wobble rules for tRNA-mRNA pairing are shown. If we assume that the tRNAs do not containmodified bases, what is the minimum number of tRNAs needed to recognize the codons for the following types of amino acids? A. Leucine B. Methionine C. Serinearrow_forward
- in a clever experiment performed in 1962, a cysteine already attached to its tRNA was chemically converted to an alanine. these “hybrid” tRNA molecules were then added to a cell- free translation system from which the normal cysteine-tRNAs had been removed. When the resulting protein was analyzed, it was found that alanine had been inserted at every point in the polypeptide chain where cysteine was supposed to be. Discuss what this experiment tells you about the role of aminoacyl- tRNA synthetases during the normal translation of the genetic code.arrow_forwardConsider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forward) A normal mRNA that reads 5'- UGCCAUGGUAAUAACACAUGAAGGCCUGAAC-3' was an insertion mutation that changes the sequence to 5'- UGCCAUGGUUAAUAACACAUGAGGCGUGAAC-3'. Translate the original mRNA and the mutated mRNA and explain how insertion mutations can have dramatic effects on proteins. ( Hint; Be sure to find the initiation site).arrow_forward
- A mutation is found in a tRNA-encoding gene. The wild type allele produces a tRNA that recognizes the codon GAA, and is charged with the amino acid Glutamic acid. The mutant tRNA is still charged with Glu, but the anticodon is mutated such that it recognizes the stop codon TAA. What effect will this have on translation in these cells? Select all that apply In the mutant cells, the stop codon TAA will always be bound by the release factors In the mutant cells, some of the synthesized proteins will be longer. O In the mutant cells, the stop codon TAA will sometimes be bound by the mutant TRNA charged with Glutamic acid. O In the mutant cells, some of the synthesized proteins will be shorter.arrow_forwardHow does the cell ensure that a specific amino acid (say, valine) attaches itself only to the one tRNA molecule that is specific for valine? (A) Proteins called aminoacyl DNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct DNA molecules carrying the right anticodon. (B) Lipids called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The lipid binds the amino acid and one of the correct tRNA molecules carrying the right codon. (C) Enzymes called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct tRNA molecules carrying the right anticodon. (D) Enzymes called peptidyl mRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct mRNA molecules carrying the right anticodon.arrow_forwardThe template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?arrow_forward
- Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forwardSickle cell disease is caused by a so-called “point mutation" in the human B-globin gene. A point mutation is the result of a single base substitution in the DNA encoding a gene. The sickle cell mutation results in substitution of Val for Glu at position 6 in the B-globin protein. (a) Using the information in Figure 5.18 explain how a point muta- tion could change a codon for Glu to a codon for Val. (b) Do you expect the pI for the sickle cell B-globin to be higher or lower than the pl for wild-type B-globin? Explain.arrow_forwardBelow is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning