Study Guide for Campbell Biology
11th Edition
ISBN: 9780134443775
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece, Martha R. Taylor, Michael A. Pollock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 17, Problem 20TYK
Summary Introduction
Introduction: Translation, also called as decoding process, is the process of synthesis of proteins or polypeptide chains. The information from messenger ribonucleic acid (mRNA) is used to build up a protein. In the ribosome, the mRNA is decoded to produce a specific chain of amino acid.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
There are 61 mRNA codons that specify an amino acid, but only 45 tRNAs. This is best explained by the fact that
A. some tRNAs have anticodons that recognize two or more different codons.
B. the rules for base pairing between the third base of a codon and tRNA are flexible.
C. many codons are never used, so the tRNAs that recognize them are dispensable.
D. A and B only
E. A, B, and C
Which of the following could be the DNA template for the following protein primary structure.
Methionine - Alanine - Asparagine - Aspartic Acid - Phenylalanine - Glutamine - stop
O a. 3' TACCGGTTACTGAAAGTTATT 5'
O b. 3' AUGGCCAAUGACUUUCAAUAA 5'
O c. 5' ATGGCCAATGACTTTCAATAA 3'
O d. 5' TACATGTAACAAGACGCCAAT 3"
Examine the following base sequence – 5’ UGA 3’. It represents the anticodon region of a particular tRNA. Based on this knowledge you know that
a.
This tRNA would be used to stop translation.
b.
This tRNA would carry the amino acid Serine to the ribosome.
c.
This tRNA would carry the amino acid Threonine to the ribosome.
d.
This tRNA would bind a TCA codon on DNA.
e.
This tRNA would not carry any amino acid to the ribosome.
f.
This tRNA would carry the amino acid Leucine to the ribosome.
Chapter 17 Solutions
Study Guide for Campbell Biology
Ch. 17 - a. In what three ways does RNA differ from DNA? b....Ch. 17 - Prob. 2IQCh. 17 - Prob. 3IQCh. 17 - How does the mRNA that leaves the nucleus differ...Ch. 17 - Prob. 5IQCh. 17 - In the following diagrams of polypeptide...Ch. 17 - What determines if a ribosome becomes bound to the...Ch. 17 - Define the following terms and explain what type...Ch. 17 - You have been introduced to several types of RNA...Ch. 17 - Prob. 2SYK
Ch. 17 - What is the genetic code? Explain redundancy and...Ch. 17 - Prepare a concept map showing the types and...Ch. 17 - Prob. 1TYKCh. 17 - Transcription involves the transfer of information...Ch. 17 - Prob. 3TYKCh. 17 - Prob. 4TYKCh. 17 - Which of the following is a statement of the...Ch. 17 - Prob. 6TYKCh. 17 - Prob. 7TYKCh. 17 - Prob. 8TYKCh. 17 - Which of the following is true of RNA processing?...Ch. 17 - Prob. 10TYKCh. 17 - Prob. 11TYKCh. 17 - Prob. 12TYKCh. 17 - Prob. 13TYKCh. 17 - Prob. 14TYKCh. 17 - What type of bonding is responsible for...Ch. 17 - Prob. 16TYKCh. 17 - Prob. 17TYKCh. 17 - Prob. 18TYKCh. 17 - Prob. 19TYKCh. 17 - Prob. 20TYKCh. 17 - Prob. 21TYKCh. 17 - Prob. 22TYKCh. 17 - Prob. 23TYKCh. 17 - Prob. 24TYKCh. 17 - Prob. 25TYKCh. 17 - Prob. 26TYKCh. 17 - Prob. 27TYKCh. 17 - Prob. 28TYK
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- All of the following apply to tRNAs EXCEPT: (more than one may apply) A. attach amino acids at the 5’ end B. have stems and loops C. are all encoded by a single gene D. an anti-codon of 5’AAC3’ corresponds to a codon of 3’UUG5’ E. exhibit distinctive 3D folds F. are acted on by 64 different aminoacyl synthetases G. are charged with amino acids by peptidyl transferasearrow_forwardWhich of the following is the mRNA coding for the peptide trp-met-gly- ser-his? A. 5'GGUGUAUGGUCUUAC-3' B. 5'-CAUUCUGGUAUGUGG-3' C. 5'-UGGAUGGGUUCUCAU-3' D. 3'-UGGAUGGGUUCUCAU-5' E. cannot be determined since the genetic code is degeneratearrow_forwardThe following diagram illustrates a step in the process of translation. Identify the following elements on the diagram.arrow_forward
- The degeneracy of the Genetic code is due to A. a 1 to 1 correlation between single amino acids and single nucleotides B. The fact that tRNAs can bind to mRNAs at the same time they transfer amino acids to a growing polypeptide chain C. The fact that there is only one start codon D. The fact that the code is non-overlapping E. The fact that more than one codon specifying an amino acid F. None of the abovearrow_forwardWhich of the following amino acid changes could result from a mutation that changed a single base? For each change that could result from the alteration of a single base, determine which position of the codon (first, second, or third nucleotide) in the mRNA must be altered for the change to result. a. Leu → Gln b. Phe → Ser c. Phe → Ile d. Pro → Ala e. Asn → Lys f. Ile → Asnarrow_forwardWhich of the following are stages of translation? Select all that apply. a.As the ribosome moves from codon to codon, amino acids brought by successive tRNAs to the ribosome form a growing polypeptide. b.A tRNA binds to the second codon and its carried amino acid forms a peptide bond with methionine. c.When the ribosome reaches a stop codon, its subunits detach, and the mRNA and new polypeptide are released. d.Ribosomal subunits and a tRNA carrying methionine converge on the start codon of an mRNA. e.The binding of a tRNA to the third codon causes the ribosome to release the first tRNA and move to the next codon.arrow_forward
- During the termination of translation, what is the correct polypeptide sequence which will be released by the ribosome? 5' - AUG - UAU - CUC - UUU - 3' (mRNA codon sequence) 3' - UAC - AUA - GAG - AAA - 5' (tRNA anticodon sequence) A.START - Tyr - Leu - Phe B. Tyr - Ile - Glu - Lys C. START - Ile - Glu - Lys D. Ser - Tyr - Gly - Cysarrow_forwardYou are studying a eukaryotic gene in which translation normally begins at the second AUG in the mRNA (underlined). The sequence surrounding both AUGs is CGGAUGCACAGGACAUCCUACCUACGGAGAUGA.... Predict the effects of the following mutations on the translation of this mRNA. Present the new sequence, highlight the changes in the sequence and consider the best context for translation. a. Change the first and second C to G b. Change the first and second C to G and also change the UAC codon before the second AUG to UAG.arrow_forwardIn addition to variable sites, the strucutre of a tRNA includes A. Three stem loops with an anticodon in the second loop; acceptor stem where amino acid attaches. B. Accepter stem where the anticodon is located; 3 stem loops with the second loop where the amino acid will attach. C. 3 stem loops with a codon in the second loop; acceptor stem where the amino acid attaches. D. Acceptor stem where the codon is located; 3 stem loops with the second loop where the amino acid will attacharrow_forward
- What is the basic recognition motif to which a N-linked glycan is added? A.S/T-X-X B.KDELC.Glycine-Leucine-Tyrosine-Cysteine-Alanine-Asparagine (G-L-Y-C-A-N) D.N-X-S/Tarrow_forwardIn an amino acyl-tRNA, the amino acid is attached to the tRNA through a(n). acid and the CCA sequence at the bond between the group of an amino of a tRNA. А. Amide; Amino terminus; 5'-phosphate В. Ester; R-group; 3'-hydroxyl C: Ester; Carboxyl terminus; 5'-phosphate D. Ester; Carboxyl terminus; 3'-hydroxyl O E. Ether; Amino terminus; 3'-hydroxyl оarrow_forwardConsider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license