a.
To explain: The meaning of saying that tRNA is a translator.
Introduction: The genetic information of DNA is based in the
b.
To fill: The given table using some of the codons and the amino acids.
Introduction: The genetic information of DNA is encrypted in the nucleotide base sequences. These sequences are transcribed into mRNA triplets and are called codons. These mRNA triplet nucleotides are then translated to form a polypeptide.
Want to see the full answer?
Check out a sample textbook solutionChapter 17 Solutions
Study Guide for Campbell Biology
- Can you help me solve this sequence question and identifty the mutation?arrow_forwardExplain the significance of the following statement: The functioning of the aminoacyl-tRNA synthetases is referred to as the second genetic code.arrow_forwardConsider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5’-UACCGAAUGUCU-3’ Note for letters a and b: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu a. Using the table of the genetic code, determine the sequence of amino acids. b. If mutation occurs by substitution of the 12th nucleotide with cytidine-5’-monophosphate, what is the resulting amino acid sequence? c. What type of mutation occurred? Choose from same sense, missense and non-sense.arrow_forward
- A mutation that changes a C to a T causes a type of Ehlers-Danlos syndrome, forming a “stop” codon and resulting in shortened procollagen. Consult the genetic code and suggest one way that this can happen.arrow_forwardBelow is a segment of RNA, transcribed from a DNA sequence. Provide an example of each kind of mutation and explain what will happen to the organism. You may choose which base to alter. Please provide the new amino acid sequence with each mutation. 5’ AUGCCUACGGACUGGCCU 3’ (Met/Pro/Thr/Asp/Trp/Pro) Use the following codon chart to help you show the translation of each sequence. a. Frameshift Mutation : b. Missense Mutation : c. Silent Mutation : d. What is the anticodon sequence of the original amino acid?arrow_forwardConsider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5'-GCAAGUCUUAAU-3' Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu 1. Using the table of the genetic code, determine the sequence of amino acids. ala-ser-leu-asn 2. If mutation occurs by substitution of the 6th nucleotide with adenosine-5'- monophosphate, what is the resulting amino acid sequence? 3. What type of mutation occurred? Choose from same sense, missense and non-sense.arrow_forward
- A. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon sequence AGACACUCUAUUAAA has a single base pair mutation to AGACACUCUUUUAAA. If the old protein sequence was Arg-His-Ser-Ile-Lys, what will be the new sequence encoded by the mutant gene?arrow_forwardDecode the unknown word using the genetic code and fill out the missing nucleotides. Translate the generated mRNA sequence using the universal genetic code table and the information derived from the previous steps. Determine the unknown word by arranging the single letter amino acid code of the hypothetical protein produced bound by the start and stop codon.arrow_forwarda. In your claim words, depict the contrast between ρ-dependent and ρ-independent end of translation in prokaryotes. b. If you have a given amino acid, can you be able to identify its RNA? Why or why not? c. How does mutation can affect the central dogma and the phenotype?arrow_forward
- Translate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'arrow_forwardDecode the unknown word using the genetic code and fill out the missing nucleotides. Translate the generated mRNA sequence using the universal genetic code table and the information derived from the previous steps. Determine the unknown word by arranging the single letter amino acid code of the hypothetical protein produced bound by the start and stop codon.arrow_forwardTranslate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education