Study Guide for Campbell Biology
11th Edition
ISBN: 9780134443775
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece, Martha R. Taylor, Michael A. Pollock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 17, Problem 8IQ
Define the following terms and explain what type of small-scale mutation could cause each of these types of mutations.
- a. silent mutation
- b. missense mutation
- c. nonsense mutation
- d. frameshift mutation
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Which of the following mutations is NOT a point mutation?
A. Missense mutation
B. Insertion mutation
C. Nonsense mutation
D. Silent mutation
A point mutation is a mutation that arises when one nucleotide in the genetic
sequence is substituted, added or deleted.
Two possible point mutations are given below:
Mutation A. Lysine is substituted for Leucine
Mutation B: Serine is substituted for Threonine
Which mutation is likely to be more serious? E Explain
Identify the best match between the mutation description and term.
a.
Transversion: results in a change in single nucleotide from a purine to another purine or a pyrimidine to another pyrimidine
b.
Nonsense mutation: a change in the DNA that changes the codon code from one amino acid to another amino acid
c.
Missense mutation: causes a drastic change in phenotype because the change causes a premature stop in the amino acid sequence
d.
Indel: has the potential to cause large changes in transcription and subsequence amino acid sequence due to reading frameshifts
Chapter 17 Solutions
Study Guide for Campbell Biology
Ch. 17 - a. In what three ways does RNA differ from DNA? b....Ch. 17 - Prob. 2IQCh. 17 - Prob. 3IQCh. 17 - How does the mRNA that leaves the nucleus differ...Ch. 17 - Prob. 5IQCh. 17 - In the following diagrams of polypeptide...Ch. 17 - What determines if a ribosome becomes bound to the...Ch. 17 - Define the following terms and explain what type...Ch. 17 - You have been introduced to several types of RNA...Ch. 17 - Prob. 2SYK
Ch. 17 - What is the genetic code? Explain redundancy and...Ch. 17 - Prepare a concept map showing the types and...Ch. 17 - Prob. 1TYKCh. 17 - Transcription involves the transfer of information...Ch. 17 - Prob. 3TYKCh. 17 - Prob. 4TYKCh. 17 - Which of the following is a statement of the...Ch. 17 - Prob. 6TYKCh. 17 - Prob. 7TYKCh. 17 - Prob. 8TYKCh. 17 - Which of the following is true of RNA processing?...Ch. 17 - Prob. 10TYKCh. 17 - Prob. 11TYKCh. 17 - Prob. 12TYKCh. 17 - Prob. 13TYKCh. 17 - Prob. 14TYKCh. 17 - What type of bonding is responsible for...Ch. 17 - Prob. 16TYKCh. 17 - Prob. 17TYKCh. 17 - Prob. 18TYKCh. 17 - Prob. 19TYKCh. 17 - Prob. 20TYKCh. 17 - Prob. 21TYKCh. 17 - Prob. 22TYKCh. 17 - Prob. 23TYKCh. 17 - Prob. 24TYKCh. 17 - Prob. 25TYKCh. 17 - Prob. 26TYKCh. 17 - Prob. 27TYKCh. 17 - Prob. 28TYK
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- define the term name as Missense mutationsarrow_forwardThe following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairingarrow_forwardWhich of the following results in the same amino acid in its protein sequence? a. missense mutation b. sense mutation c. nonsense mutation d. antisense mutationarrow_forward
- Name three different types of loss of function mutations and in each case explain how the mutation exerts a loss of function effect on a genearrow_forwardTwo types of mutations discussed in this chapter are (1) nucleotide changes and (2) unstable genome regions that undergo dynamic changes. Describe each type of mutation.arrow_forwardAlthough it is well known that X-rays cause mutations, they are routinely used to diagnose medical problems, including potential tumors, broken bones, and dental cavities. Why is this done? What precautions need to be taken?arrow_forward
- The figure shows the position of two of these mutations a and b. The nucleotides are altered in these 2 different swo-1 mutant alleles. Use the genetic table to describe any AA changes.Name the type of mutation and describe its effect on swo-1 mRNA and protein for each of the mutations. 3. The swo-1 a mutation (insertion between C and G). 4. The swo-1 b mutation (C-to-T mutation for indicated C). 5. The swo-1 a mutation leads to worms with more body wall muscle, whereas worms with the swo-1 b mutation are not able to move. Based on these phenotypes and the findings from questions 3 and 4, describe the role thewild-type version of this protein plays in muscle function.arrow_forwardA protein is normally secreted from the cell. A team of scientists attempts to redirect this protein to the inside of the nucleus by mutating the sequence of the gene. Unfortunately, after this mutation, the protein is no longer secreted, but it is now localized to the cytosol and not the nucleus. Briefly answer the two questions below: Identify the sequence that was mutated by the scientists and explain your reasoning. a. b. What additional mutation must be made by the scientists to redirect this protein to the nucleus? Explain your reasoning.arrow_forwardIf we have the following mutations, find the type of the mutation (silent or missense or nonsense?)c.17CUc.36GAc.49GUc.115ACarrow_forward
- A SNV mutation that results in no change in the amino acid sequence is called: A. silent mutation B. silencing mutation C. missense mutation D. nonsense mutation E. frameshift mutationarrow_forwardThe change of a UAC codon (Tyr) to a UAG codon (Stop) is an example of a: A. nonsense mutation B. frameshift mutation C. silent mutation D. missense mutationarrow_forwardA neutral mutation is, by definition, a mutation that does not result in the change of the encoded amino acid sequence of a gene. 1)True 2)Falsearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY