Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 11, Problem 23P
A partial sequence of the wild-type HbβA allele is shown here (the top strand is the RNA-like coding strand, and the location of the disease-causing mutation is underlined):
and the sickle-cell allele HBβ sequence is:
Design two 21-
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A purified recombinant protein is analyzed for molecular weight by SDS-PAGE at pH 8.5. From the protein sequence deduced from the gene that was expressed in bacteria, the protein is expected to have a molecular weight of 44,000. However, the molecular weight of the protein is found by SDS-PAGE to be 52,000. Explain the reason or reasons for this difference in molecular weight. What calculation could you make to help explain this discrepancy?
Using the Dynamic Programming algorithm for pairwise local alignment we covered in class, construct the dynamic programming score table for a local alignment of the following two sequences, using the following scoring parameters: match score = +5, mismatch score = -3, gap penalty = -2.: ACGTATCGCGTATA GATGCTCTCGGAAAWhat is score of the best local alignment between these two sequences? Show the alignment of these sequences.
asap
Calculate the dynamic programming matrix and the optimal local and global
alignment for the DNA sequences
a: GAATTC and b: GATTA,
scoring +2 for a match,
-1 for a mismatch,
and using a linear gap penalty function WL) = -2L
thank you
Chapter 11 Solutions
Genetics: From Genes to Genomes
Ch. 11 - Choose the phrase from the right column that best...Ch. 11 - Would you characterize the pattern of inheritance...Ch. 11 - Would you be more likely to find single nucleotide...Ch. 11 - A recent estimate of the rate of base...Ch. 11 - If you examine Fig. 11.5 closely, you will note...Ch. 11 - Approximately 50 million SNPs have thus far been...Ch. 11 - Mutations at simple sequence repeat SSR loci occur...Ch. 11 - Humans and gorillas last shared a common ancestor...Ch. 11 - In 2015, an international team of scientists...Ch. 11 - Using PCR, you want to amplify an approximately 1...
Ch. 11 - Prob. 11PCh. 11 - The previous problem raises several interesting...Ch. 11 - You want to make a recombinant DNA in which a PCR...Ch. 11 - You sequence a PCR product amplified from a...Ch. 11 - Prob. 15PCh. 11 - The trinucleotide repeat region of the Huntington...Ch. 11 - Sperm samples were taken from two men just...Ch. 11 - Prob. 18PCh. 11 - a. It is possible to perform DNA fingerprinting...Ch. 11 - On July 17, 1918, Tsar Nicholas II; his wife the...Ch. 11 - The figure that follows shows DNA fingerprint...Ch. 11 - Microarrays were used to determine the genotypes...Ch. 11 - A partial sequence of the wild-type HbA allele is...Ch. 11 - a. In Fig. 11.17b, PCR is performed to amplify...Ch. 11 - The following figure shows a partial microarray...Ch. 11 - Scientists were surprised to discover recently...Ch. 11 - The microarray shown in Problem 25 analyzes...Ch. 11 - The figure that follows shows the pedigree of a...Ch. 11 - One of the difficulties faced by human geneticists...Ch. 11 - Now consider a mating between consanguineous...Ch. 11 - The pedigree shown in Fig. 11.22 was crucial to...Ch. 11 - You have identified a SNP marker that in one large...Ch. 11 - The pedigrees indicated here were obtained with...Ch. 11 - Approximately 3 of the population carries a mutant...Ch. 11 - The drug ivacaftor has recently been developed to...Ch. 11 - In the high-throughput DNA sequencing protocol...Ch. 11 - A researcher sequences the whole exome of a...Ch. 11 - As explained in the text, the cause of many...Ch. 11 - Figure 11.26 portrayed the analysis of Miller...Ch. 11 - A research paper published in the summer of 2012...Ch. 11 - Table 11.2 and Fig. 11.27 together portray the...Ch. 11 - The human RefSeq of the entire first exon of a...Ch. 11 - Mutations in the HPRT1 gene in humans result in at...Ch. 11 - Prob. 44P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 1) You wish to make a restriction map of a 17.0 kb linear fragment. You digest the fragment with Sbf1, Pst1, and a mixture of Sbf1 and Pst1. From these results, you obtain these fragments following agarose gel electrophoresis of the three samples: Sbf1: 7kb and 10kb Pstl: 3kb, 6kb and 8kb Sbf1 and Pstl: 1kb, 2kb, 6kb and 8kb Question: In which of the Pstl fragments is the Sbfl site located? 8kb O 6kb 3kb O None of the abovearrow_forwardThe human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…arrow_forwardCompared to the normal A allele, the disease-causing allele in sickle cell anemia (S allele) is missing an MstII restriction site. On a Southern blot of genomic DNA cut with MstII and hybridized with the probe shown on the diagram below, a person with sickle anemia, carrying two S alleles, will show Choose an answer below: a single band at 1.1 kb. a single band at 1.3 kb. a single band at 0.2 kb. one band at 0.2 and one at 1.3 kb. one band at 1.1 and one at 1.3 kb.arrow_forward
- The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCGarrow_forwardThe chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?arrow_forwardRecombination signal sequences are conserved heptamer and nonamer sequences that flank the V, J, and D gene segments which undergo recombination to generate the final V region coding exon. Some of these have 12-nucleotide spacers between the heptamer and nonamer, and others have 23-nucleotide spacers. The reason recombination signal sequences come in these two forms is: To ensure the correct assembly of gene segments so that a VH recombines to a DH and not to another VH, for instance To ensure that the heptamer and nonamer are found on the same face of the DNA double helix To ensure that alpha, lambda, and heavy chains recombine within a locus and not between loci To ensure that alpha, lambda, and heavy chain gene segments do not undergo recombination with non-immunoglobulin genes To ensure that the RAG recombinase cuts the DNA between the last nucleotide of the heptamer and the coding sequencearrow_forward
- The DNA sequence of the genome of a virus is known and contains equal number of A, TG and C. The genome is composed of double stranded DNA molecule. It is 10Kb in length. If one searches the genome for the presence of the following sequence 5'-AAAAAA-3'/3'-TTTTTT-5', predict the number of such stretches that are likely to occur. (1Kb = 1000 base pairs). a) Two b) Eight c) Sixteen d) Thirty twoarrow_forwardA recombinant protein corresponding to 52 repeats of the peptide sequence YSPTSPS was covalently linked to agarose beads to make an affinity column. The beads were incubated with a nuclear extract and the protein:beads became phosphorylated. More nuclear extract was run over the column repeatedly and then the beads were washed extensively. The bound proteins were eluted from the column and when they were separated on a SDS-PAGE gel many bands appeared. What cellular process(es) might these proteins be involved in? Options: splicing polyadenylation DNA replication a and b only a, b and carrow_forwardExplain the predicted results with the diagrams presented. the cut plsmid is 5.9kb, and a gene insert is 720 bp. 1) ligation 2) self ligation of two vectors 3) self ligation of two inserts 4) ligation of a vector with multiple inserts. also how many inserts can be ligated into a vector 5) ligation of one insert into a vectorarrow_forward
- That's the result of Gel electrophoresis of genomic DNA ( Of genomic DNA extraction experiment), please discuss the results and label and name the image to illustrate the answer? - Marker band sizes in gel: From top (well side) to bottom the bands have the following size in base-pair/bp- 6751,3652,2827,1568,1118,825,630arrow_forwardBelow are 9 possible primer pairs. ● Determine which primer pair is the best choice by considering the following: 1. primers should be 18-24 bases in length; 2. base composition should be 45-55% (G+C); 3. primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming; 4. Tms tween 55-70°℃ are preferred (Tas, annealing temperatures, are approximately 5°C lower than the Tm); 5. the Tm for your primer pair should be within 2 degrees of each other, though ideally the same; 6. runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided; 7. 3'-ends of primers should not be complementary (i.e. base pair), as otherwise the formation of primer dimers will result; 8. primer self-complementary (ability to form secondary structures such as hairpins) should be avoided. • Explain why the other primers are not good choices. ● Underline or…arrow_forwardA 13-nucleotide section of an autoradiogram from a Sanger sequencing experiment is depicted in the image below. Based on the band pattern observed here, write out the sequence of both the complementary strand generated during the experiment, and the template strand that is being analyzed. Be sure to clearly indicate the 5' and 3' ends of each. ddATP ddGTP ddCTP || | | ddTTP | 3' 5' Tyne a short answer in the space provided belowarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY