
Concept explainers
Choose the phrase from the right column that best fits the term in the left column.
a. DNA polymorphism | DNA elements composed of short tandemly repeated sequences |
b. phase | two different |
c. informative cross | arrangement of alleles of two linked genes in a diploid |
d. ASO | location on a chromosome |
e. SNP | a DNA sequence that occurs in two or more variant forms |
f. DNA fingerprinting | a short oligonucleotide that will hybridize to only one allele at a chose SNP locus |
g. SSR | detection of genotype at a number of unlinked highly polymorphic loci |
h. locus | allows identification of a gamete as recombinant or nonrecombinant |
i. compound heterozygote | all exons in a genome |
j. exome | individuals with two different mutations in the same gene |

a.
To determine:
The phrase that describes “DNA polymorphism” among the options given below:
1. DNA elements composed of short tandemly repeated sequences |
2. two different nucleotides appear at the same position in genomic DNA from different individuals |
3. arrangement of alleles of two linked genes in a diploid |
4. location on a chromosome |
5. a DNA sequence that occurs in two or more variant forms |
6. a short oligonucleotide that will hybridize to only one allele at a chose SNP locus |
7. detection of genotype at a number of unlinked highly polymorphic loci |
8. allows identification of a gamete as recombinant or nonrecombinant |
9. all exons in a genome |
10. individuals with two different mutations in the same gene |
Introduction:
DNA (deoxyribonucleic acid) is packaged in a chromosome as two spiraling strands. These two strands twist together to form a double helix structure.
Answer to Problem 1P
Correct answer:
DNA polymorphism: A DNA sequence that occurs in two or more variant forms
Explanation of Solution
DNA polymorphism refers to a DNA sequence that occurs in two or more alleles at a locus.

b.
To determine:
The phrase that describes “phase” among the options given below:
1. DNA elements composed of short tandemly repeated sequences |
2. two different nucleotides appear at the same position in genomic DNA from different individuals |
3. arrangement of alleles of two linked genes in a diploid |
4. location on a chromosome |
5. a DNA sequence that occurs in two or more variant forms |
6. a short oligonucleotide that will hybridize to only one allele at a chose SNP locus |
7. detection of genotype at a number of unlinked highly polymorphic loci |
8. allows identification of a gamete as recombinant or nonrecombinant |
9. all exons in a genome |
10. individuals with two different mutations in the same gene |
Introduction:
The term phase is also described as linkage phase. The occurrence of two dissimilar genes on same chromosome is defined as linkage.
Answer to Problem 1P
Correct answer:
Phase: Arrangement of alleles of two linked genes in a diploid
Explanation of Solution
The arrangement of the alleles of linked genes on two parental chromosomes referred to as the linkage phase.

c.
To determine:
The phrase that describes “informative cross” among the options given below:
1. DNA elements composed of short tandemly repeated sequences |
2. two different nucleotides appear at the same position in genomic DNA from different individuals |
3. arrangement of alleles of two linked genes in a diploid |
4. location on a chromosome |
5. a DNA sequence that occurs in two or more variant forms |
6. a short oligonucleotide that will hybridize to only one allele at a chose SNP locus |
7. detection of genotype at a number of unlinked highly polymorphic loci |
8. allows identification of a gamete as recombinant or nonrecombinant |
9. all exons in a genome |
10. individuals with two different mutations in the same gene |
Introduction:
The forms of genetic crossese are informative cross, testcross, backcross, monohybrid cross, and dihybrid cross.
Answer to Problem 1P
Correct answer:
Informative cross: Allows identification of a gamete as recombinant or nonrecombinant
Explanation of Solution
The genetic crosses that allow the identification of recombinant and nonrecombinant gametes are known as informative crosses.

d.
To determine:
The phrase that describes “ASO” among the options given below:
1. DNA elements composed of short tandemly repeated sequences |
2. two different nucleotides appear at the same position in genomic DNA from different individuals |
3. arrangement of alleles of two linked genes in a diploid |
4. location on a chromosome |
5. a DNA sequence that occurs in two or more variant forms |
6. a short oligonucleotide that will hybridize to only one allele at a chose SNP locus |
7. detection of genotype at a number of unlinked highly polymorphic loci |
8. allows identification of a gamete as recombinant or nonrecombinant |
9. all exons in a genome |
10. individuals with two different mutations in the same gene |
Introduction:
The full form of ASO is allele-specific oligonucleotide. Short deoxyribonucleic acid or ribonucleic acid polymers are defined as oligonucleotide.
Answer to Problem 1P
Correct answer:
ASO: A short oligonucleotide that will hybridize to only one allele at a chosen SNP locus
Explanation of Solution
ASO refers to short 20 to 40 base long oligonucleotides that will hybridize under specific conditions to only one of the two alleles at SNP locus.

e.
To determine:
The phrase that describes “SNP” among the options given below:
1. DNA elements composed of short tandemly repeated sequences |
2. two different nucleotides appear at the same position in genomic DNA from different individuals |
3. arrangement of alleles of two linked genes in a diploid |
4. location on a chromosome |
5. a DNA sequence that occurs in two or more variant forms |
6. a short oligonucleotide that will hybridize to only one allele at a chose SNP locus |
7. detection of genotype at a number of unlinked highly polymorphic loci |
8. allows identification of a gamete as recombinant or nonrecombinant |
9. all exons in a genome |
10. individuals with two different mutations in the same gene |
Introduction:
SNP is referred to as single nucleotide polymorphism. The differnce in the sequence of nucleotide between the living beings is described as polymorphism.
Answer to Problem 1P
Correct answer:
SNP: Two different nucleotides appear at the same position in genomic DNA from different individuals
Explanation of Solution
SNP refers to a single nucleotide locus with two naturally existing alleles described by single base pair substitution.

f.
To determine:
The phrase that describes “DNA fingerprinting” among the options given below:
1. DNA elements composed of short tandemly repeated sequences |
2. two different nucleotides appear at the same position in genomic DNA from different individuals |
3. arrangement of alleles of two linked genes in a diploid |
4. location on a chromosome |
5. a DNA sequence that occurs in two or more variant forms |
6. a short oligonucleotide that will hybridize to only one allele at a chose SNP locus |
7. detection of genotype at a number of unlinked highly polymorphic loci |
8. allows identification of a gamete as recombinant or nonrecombinant |
9. all exons in a genome |
10. individuals with two different mutations in the same gene |
Introduction:
DNA (deoxyribonucleic acid) fingerprinting refers to a technique that is generally utilized for forensic purposes.
Answer to Problem 1P
Correct answer:
DNA fingerprinting: Detection of genotype at a number of unlinked highly polymorphic loci
Explanation of Solution
In DNA fingerprinting, genotyping of multiple polymorphic loci provides information to identify people from their DNA.

g.
To determine:
The phrase that describes “SSR” among the options given below:
1. DNA elements composed of short tandemly repeated sequences |
2. two different nucleotides appear at the same position in genomic DNA from different individuals |
3. arrangement of alleles of two linked genes in a diploid |
4. location on a chromosome |
5. a DNA sequence that occurs in two or more variant forms |
6. a short oligonucleotide that will hybridize to only one allele at a chose SNP locus |
7. detection of genotype at a number of unlinked highly polymorphic loci |
8. allows identification of a gamete as recombinant or nonrecombinant |
9. all exons in a genome |
10. individuals with two different mutations in the same gene |
Introduction:
The full form of SSR is simple sequence repeats, and these repeats are also known as microsatellites.
Answer to Problem 1P
Correct answer:
SSR: DNA element composed of short tandemly repeated sequences:
Explanation of Solution
The loci of SSR consist of sequences of few bases that are repeated in tandem less than ten to more than hundred times.

h.
To determine:
The phrase that describes “locus” among the options given below:
1. DNA elements composed of short tandemly repeated sequences |
2. two different nucleotides appear at the same position in genomic DNA from different individuals |
3. arrangement of alleles of two linked genes in a diploid |
4. location on a chromosome |
5. a DNA sequence that occurs in two or more variant forms |
6. a short oligonucleotide that will hybridize to only one allele at a chose SNP locus |
7. detection of genotype at a number of unlinked highly polymorphic loci |
8. allows identification of a gamete as recombinant or nonrecombinant |
9. all exons in a genome |
10. individuals with two different mutations in the same gene |
Introduction:
Locus term is sometimes also defined as a gene. The term gene refers to the primary unit of heredity.
Answer to Problem 1P
Correct answer:
Locus: Location on a chromosome
Explanation of Solution
Locus refers to a designated location on a chromosome. Inside the nucleus, the molecule of DNA is packaged into a specific structure known as chromosome.

i.
To determine:
The phrase that describes “compound heterozygote” among the options given below:
1. DNA elements composed of short tandemly repeated sequences |
2. two different nucleotides appear at the same position in genomic DNA from different individuals |
3. arrangement of alleles of two linked genes in a diploid |
4. location on a chromosome |
5. a DNA sequence that occurs in two or more variant forms |
6. a short oligonucleotide that will hybridize to only one allele at a chose SNP locus |
7. detection of genotype at a number of unlinked highly polymorphic loci |
8. allows identification of a gamete as recombinant or nonrecombinant |
9. all exons in a genome |
10. individuals with two different mutations in the same gene |
Introduction:
The individual containing two types of alleles for a particular gene is described as the heterozygote.
Answer to Problem 1P
Correct answer:
Compound heterozygote: Individual with two different mutations in the same gene
Explanation of Solution
Compound heterozygote refers to an individual that contain two different mutant alleles of the same gene.

j.
To determine:
The phrase that describes “exome” among the options given below:
1. DNA elements composed of short tandemly repeated sequences |
2. two different nucleotides appear at the same position in genomic DNA from different individuals |
3. arrangement of alleles of two linked genes in a diploid |
4. location on a chromosome |
5. a DNA sequence that occurs in two or more variant forms |
6. a short oligonucleotide that will hybridize to only one allele at a chose SNP locus |
7. detection of genotype at a number of unlinked highly polymorphic loci |
8. allows identification of a gamete as recombinant or nonrecombinant |
9. all exons in a genome |
10. individuals with two different mutations in the same gene |
Introduction:
The term exome refer to coding parts of the genes. Genes are the primary functional and physical unit of heredity.
Answer to Problem 1P
Correct answer:
Exome: All exons in a genome
Explanation of Solution
Exome refers to the collection of all exons of all the genes and constitutes less than two percent of whole-genome DNA.
Want to see more full solutions like this?
Chapter 10 Solutions
Genetics: From Genes to Genomes, 5th edition
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningCase Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:CengageConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College




