Answered: Would the oligonucleotide primers used…

Would the oligonucleotide primers used in Lab 3 to detect the GFP transgene and GFP MRNA also detect the GFP hairpin transgene in pUQC218?

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter32: The Reception And Transmission Of Extracellular Information

Section: Chapter Questions

Problem 17P

See similar textbooks

Related questions

Q: Why are the correct primer sequences essential for successful amplification?

A: Polymerase chain reaction (PCR) is a widely used method in molecular biology that is used to make…

Q: With regard to the CRISPR-Cas system that defends bacteriaagainst bacteriophage attack, what happens…

A: Bacteriophage are the viruses which infects bacteria. CRISPR that is Clustered Regularly…

Q: Researchers have identified a gene (FR) responsible for watermelon resistance to infection by Dacus…

A: Any abrupt changes in DNA or RNA nucleotides that may or may not be responsible for the changes in…

Q: Resistance Gene." a) Using the diagram provided, describe where the forward and reverse primers…

A: # Here I have solved first part of the first question . Please send questions one by one in the…

Q: What is it about the Cas9 protein that makes it an efficient DNAediting tool?

A: DNA and RNA are the genetic elements present in almost all cells. DNA encodes for proteins through…

Q: You run a Western blot to detect Ras in sampe A and sample B. You find that sample B gives a darker…

A: First of all, Western Blot is a technique which is used to detect the expression of protein from…

Q: Explain how HOTAIR plays a role in the transcriptional regulationof particular genes.

A: A gene is a sequence of nucleotides in genome that codes for a functioning molecule. There is…

Q: In the absence of tryptophan and the trpD structural gene contains a frameshift insertion mutation,…

Q: The carboxy terminus of the p53 protein acts as an allosteric regulator of sequence-specific DNA…

A: General structure of p53 protein

Q: What is Taq polymerase and why is it important?

A: DNA Polymerase is a very important enzyme in the process of DNA Replication. It is a process in…

Q: 5' ATGATCTCGTAA 3' 3' TACTAGAGCATT 5'

A: DNA, or deoxyribonucleic acid, is a hereditary molecule that encodes the blueprint for the growth,…

Q: Mark promoter and terminator

A: DNA, or deoxyribonucleic acid, is the genetic material that carries the instructions for the…

Q: Propose a mutation for Uniprotkb-P39086 and it’s effec

A: Mutations are the result of damage or alteration of a DNA such that the genetic message it conveys…

Q: can BRCA1 null mutant transcribe any genes

A: The genes BRCA1 and BRCA2 (BReast CAncer genes 1 and 2, respectively) generate proteins that help in…

Q: What are site-recombinases? Describe in detail how cre- recombinase can be used to decipher the…

A: Genetic recombination is the transfer of genetic material between organisms, resulting in offspring…

Q: Explain the Construction of a directional cDNA library for RNA-Seq?

A: A sequencing library is, by definition, a pool of DNA sections with adapters joined. These are…

Q: What is c3435T mutataion,What is the clinical implication of c3435T mutation, what is the molecular…

A: A mutation is an alteration that changes a nucleotide of nucleic acid. It mainly involves the…

Q: 11) Draw a bacterial expression vector with all require vector sequences. Be sure to label any…

A: Bacterial expression vectors are used to introduce foreign genetic material into a host in order to…

Concept explainers

Genomic studies

Genomic studies (genomics) is the study of the whole genome of an organism. Using bioinformatics and high-performance computing, genomic researchers examined massive amounts of deoxyribonucleic acid (DNA)-sequence data to discover variations or mutations that affect drug response, health, or disease. Genomics is a much younger discipline than genetics, having only emerged in the last few decades as a result of technological advancements in DNA sequencing and computational biology.

Question

Expression and Silencing of GFP
1. Would the oligonucleotide primers used in Lab 3 to
detect the GFP transgene and GFP MRNA also detect
the GFP hairpin transgene in pUQC218?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

please give thorough explanation for why answer is B plz do not answer question if u don't actually understand thank you
GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
Mutants that are lacY- retain the capacity to synthesizeβ-galactosidase. However, even though the lacI gene isstill intact, β-galactosidase can no longer be induced byadding lactose to the medium. Explain
Label promoter and terminator regions
draw the p21 promoter. Your drawing should include (1) the start site, (2) the TATA box and (3) the ERE/AP-1 binding site
Cell signaling The maximum secretion rates of proteins are one type of limiting constraint on signal-ing processes since a cell cannot send a signal faster than it can secrete it. These maximum signalingrates can be estimated with maximum rates of transcription and translation. Consequently, proteins withstrong promoters can be synthesized at much higher rates. Immunoglobulins, which are important signal-ing molecules, have very strong promoters. Their maximum secretion rate is on the order of 2000 to 8000antibody molecules/cell/second, which corresponds to approximately 1 pg/cell/hr. Part AWhat would be the maximum signal (in pg/cell/hr) that a cell could send for the following situations: (1)Signal molecule A has a MW = 100,000 daltons and is secreted at a rate of 1000 molecules/cell/second. (2)Signal molecule B has a MW = 50,000 daltons and is secreted at 5000 molecules/cell/second.Part BWhich molecule is secreted at a higher rate? By how much?Part CIf equivalent fluxes of both…
An important mechanism for generating diversity in immunoglobulin light chain V-region sequences is based on the fact that the RAG recombinase generates hairpin structures, rather than blunt ends, at the cleavage sites between the recombination signal sequences and the coding sequences. Explain how this mechanism generates diversity at the junctions.
IG-LA ED What pattern of functional protein synthesis of ß-galactosidase and permease, respectively, would you expect from an I*P*OCZ+Y+ lac operon in the absence of lactose? O ++ O -- O +- O+
As shown a genetic switch that controls the choicebetween the lytic and lysogenic cycles of phage λ. What is agenetic switch? Compare the roles of a genetic switch and a simpleoperator site (like the one found in the lac operon) in generegulation.
In Figure 12-19, where is the TATA box located before theenhanceosome forms at the top of the figure?
Please do all.
Regulation of Genes and Their products 1. Given the following genotypes, explain how the mutation (identified by a (-) superscript) wil affect E. coll grown in lactose medium. Will the lac operon be on or off? Will there be a complete set of gene products from the lac operon? What will be the implication of the missing gene product, if ever? Will the cell be able to survive in the lactose medium or not? a. I+p+o+z- y+ b. i- p+o+z+y+ c. i+p+o- z+y+ d. i+p- o+z+y+ 2. In terms of the trp operon, differentiate between two normal bacterial cultures, one grown in a medium supplied with tryptophan and the other medium without tryptophan. 3. Experiments show that mutations at gene E lead to non-repressible transcription of trp genes. Why?