Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 28, Problem 15P
Recombination in Immunoglobulin Genes If recombination between a
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
AAAGAGAAAAGAAUA
to AAAGAGAAAUGAAUA.
Suppose the codon sequence
has a single base pair mutation
If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene?
(Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.)
Submit Answer
Retry Entire Group No more group attempts remain
Binding of --------- identifies the decoding center of the ribosome.
3
Chapter 28 Solutions
Biochemistry
Ch. 28 - Semiconservative or Conservative DNA Replication...Ch. 28 - The Enzymatic Activities of DNA Polymerase I (a)...Ch. 28 - Multiple Replication Forks in E. coli I Assuming...Ch. 28 - Multiple Replication Forks in E. coli II On the...Ch. 28 - Molecules of DNA Polymerase III per Cell vs....Ch. 28 - Number of Okazaki Fragments in E. coli and Human...Ch. 28 - The Roles of Helicases and Gyrases How do DNA...Ch. 28 - Human Genome Replication Rate Assume DNA...Ch. 28 - Heteroduplex DNA Formation in Recombination From...Ch. 28 - Homologous Recombination, Heteroduplex DNA, and...
Ch. 28 - Prob. 11PCh. 28 - Prob. 12PCh. 28 - Chemical Mutagenesis of DNA Bases Show the...Ch. 28 - Prob. 14PCh. 28 - Recombination in Immunoglobulin Genes If...Ch. 28 - Helicase Unwinding of the E. coli Chromosome...Ch. 28 - Prob. 17PCh. 28 - Functional Consequences of Y-Family DNA Polymerase...Ch. 28 - Figure 28.11 depicts the eukaryotic cell cycle....Ch. 28 - Figure 28.41 gives some examples of recombination...Ch. 28 - Prob. 21PCh. 28 - Prob. 22P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Chain termination/Nonsense mutation - no a.a. that corresponds to a new base sequence; results to the appearance of nonsense codon DNA Sequence : TGG GTC CGG CCC AAT 3. What is the new DNA sequence and the corresponding new amino acid sequence When there is a T-substitution in the 14th N-base?arrow_forwardCentral Dogma of Molecular Biology from DNA to RNA to Protein, discussing the principles underlying the transfer of information in a biologic system and its regulation. However, recent research seems to challenge certain aspects of Crick’s Central Dogma. Does the Central Dogma still stand today? If not, can you find an example for a type of information transfer that is not explicitly covered by the Central Dogma (or even violates it)?arrow_forwardDo not use Aiarrow_forward
- What are the functional consequences of this deletion for lilP mRNA transcription and translation? (100 words max.)arrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forwardGiven the following diagram of how protein AWESOME1 binds to it's target DNA, describe the potential effects of each of the 5 mutations shown below. The wild-type sequence of a helix #1 is also shown in the blue box, and all the mutations are in helix #1 (see numbers for identifying particular residues). a helix #1 R(1)-V-I-L-Y-F-W-I-M-Y-F-S-H-Y-W-R(16) #1 Predict the consequence of the following mutations: 1) Arg(1) to Glu 2) Arg(1) to Ala 3) Phe(6) to lle 4) Trp(7) to Phe 5) Met(9) to Pro inarrow_forward
- Nonearrow_forwardTHE MOLECULAR GENETICS OF CYSTIC FIBROSIS 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA? The following is the base sequence of DNA that codes for amino acids 506-510 of the protein that regulates the chlorine channels in the cell membrane. This protein contains a total of 1476 amino acids so this is a small part of the entire gene. DNA Template Strand: TAGTAGAAACCACAA 1. What is the minimum number of DNA nucleotides in this whole gene? 4. What amino acids will this mRNA code for? 5. If the 6th, 7th and 8th bases in the template strand of the DNA are removed, rewrite the new template strand below. 1 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 7. What mRNA will be formed from the mutated template strand of DNA? 8. What amino acids will this new mRNA from the mutated template strand code for? 9. Are these…arrow_forwardIdentify the various secondary structures in the β1 immunoglobulin-binding domain of protein G (GB1). Is the helix right-handed or left-handed? Is the β-sheets parallel, anti-parallel, or both ? What an elegant protein! - So beautiful.arrow_forward
- GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.arrow_forwardThe subunits of the translation initiation complex in PROKARYOTES.* 1 point O 30S and 50S O 40S and 60S O 20S and 60S O 10S and 70S Normal pH of the human blood? * 1 point O 7.30 to 7.40 O 7.35 to 7.45 O 7.40 to 7.50 O 7.45 to 7.55 A structural motif that contains 2 cysteine and 2 histidine amino acids. * I point Helix-turn-helix Motifarrow_forwardOn average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in thecourse of synthesizing a 200 amino acid protein? Assume that you begin with the mature mRNA,ribosomal subunits, tRNAs, free amino acids, and all necessary factors.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license