Which restriction endonucleases would cleave a DNA molecule at the given sequences? The complementary DNA substrate strand is omitted for clarity. 5' ATCGAACTAGGCC 3' 5' AAAGCTTGTGATATC 3' EcoRI EcoRI EcoRV EcoRV HaellII HindIII HindIII HaellI
Q: For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show…
A: Polymerase (PCR) chain reaction is a process in which small DNA fragments are amplified into a…
Q: 1. (a) Restriction sites are usually ______. Recombinant DNA Technology Restriction…
A: Given, 1. (a) Restriction sites are usually ______. Recombinant DNA Technology…
Q: Define the following terms:a. hypochromic effectb. DNA denaturationc. restriction endonucleasesd.…
A: Recombinant DNA is made by combining two or more DNA from other sources. The process depends on the…
Q: On the gel shown below are four DNA samples. Samples A to C are taken from tissues of landslide…
A: The gel electrophoresis is used to separate the DNA fragments according to their sizes. The smaller…
Q: Enzymes of bacterial origin used in a wide variety of techniques are: ligases restriction…
A: DNA polymerase
Q: The plasmid PSU922 is a circular DNA containing 25000 base pairs. The B-gal gene codes for the…
A: Restriction endonucleases, often known as restriction enzymes, are found in all prokaryotes. The…
Q: PCR primers Below is a 300 base pair fragment of DNA. The top strand is written in the 5' to 3'…
A: The PCR is known as a polymerase chain reaction in which the DNA template is amplified with the help…
Q: 3. A plasmid was cleaved with several restriction enzymes, individually and in combinations. The…
A: Restriction mapping is a technique for mapping an unknown section of DNA by breaking it down into…
Q: Based on the restriction enzyme specificities given below, what was the enzyme utilized to produce…
A: An enzyme that recognizes a specific sequence on the DNA strand and cuts the DNA into fragments is…
Q: EcoR1 is a restriction enzyme that cuts DNA at the following base sequence: 5' GAATTC 3' Which…
A: The restriction enzyme cuts the DNA at the specific recognition sequence.
Q: Match the term with its description.
A: There are various enzymes and gene components that are studied in techniques of genetic engineering.…
Q: Which of the restriction enzymes listed in the table below produces blunt-end fragments? Enzyme…
A: The blunt end are produced by the restriction enzymes when the end of a DNA fragment after breaking…
Q: A fragment of DNA is cloned into a plasmid witha sequencing primer binding site. After dideaxy…
A: DNA sequencing is a process of identifying the order of nucleic acid bases i.e. adenine, guanine,…
Q: A 3000 bp circular DNA was treated with both HindIII and EcoRI restriction enzymes. EcoRI cuts at…
A: In this question, we are given two restriction enzymes EcoRI and HindIII with their restricting…
Q: Based on the restriction enzyme specificities given below, what was the enzyme utilized to produce…
A: The corner stone of genetic engineering or recombinant DNA technology is a special class of enzymes…
Q: following site does the restriction enzymes act? 32. Restriction Fragment Length Polymorphism (RFLP)…
A: Restriction endonucleases are enzymes that cuts the DNA at specific DNA sequence known as…
Q: Which two restriction enzymes where used to completely digest the DNA fragment above based on the…
A: Restriction endonucleases are the enzymes which cleave the DNA at specific sites from within and…
Q: A piece of DNA 5.0 kb long is cloned and then cut out of the vector for analysis. This linear piece…
A: Restriction enzyme is any enzyme that cleaves DNA at a particular sequence. Example - BamHI, EcoRI,…
Q: Why is it necessary to use a special DNA polymerase(Taq polymerase) in PCR?
A: PCR (Polymerase Chain Reaction) is a technique that is used to amplify specific DNA sequences. The…
Q: The same restriction endonuclease must be used to excise the foreign DNA and bacterial DNA. Select…
A: DNA or deoxyribonucleic acid is a double-stranded molecule, strands of which are coiled around one…
Q: A molecule of double-stranded DNA that is 5 million base pairs long has a base composition that is…
A: If a molecule of double-stranded DNA which is 5 million base pairs long, has a base composition that…
Q: Which of the following is required to make complementary DNA (CDNA) from RNA? reverse transcriptase…
A: The central dogma in cell biology is DNA -> RNA -> Protein. The first process is the…
Q: Suppose that a geneticist discovers a new restriction enzyme in the bacterium Aeromonas ranidae.…
A: Restriction enzymes or restriction endonucleases are the enzymes that cut the DNA strand at specific…
Q: GAATTC GAATTO CITAAG CITAAG double-stranded DNA DAATT DAATTO CTAA G CTAA GI AAT TO CTTAA GAATTO…
A: The cloning is routinely used in biotechnology laboratories and it is the process by which a foreign…
Q: Which of the following is most likely to be a restriction enzyme recognition sequence? O AAAAAA O…
A: A palindromic sequence is a sequence of nucleic acids within double helix of DNA and / or RNA that…
Q: Another restriction enzyme is called HaellI. It cuts DNA at the following base sequence: CCGG GGCC…
A: restriction enzymes are those enzymes which helps in cutting dna at specific locations .
Q: Dr. Doom has a DNA sequence of 2000 bp. Enzyme X and Enzyme Y restriction sites and their positions…
A: Restriction enzymes are the enzymes which cut DNA at particular site.
Q: All of the following enzymes would be used by a bacterium to copy its genome EXCEPT A. Helicase B.…
A: RNA replicase Reichetal showed the RNA synthesis even in the presence of actinomycin-D(that…
Q: PCR primers Below is a 300 base pair fragment of DNA. The top strand is written in the 5' to 3'…
A: Introduction A primer is a single-stranded nucleic acid that all living organisms utilise to start…
Q: DNA samples from four individuals were cleaved with the same MW restriction endonuclease. The DNA…
A: Any human biological specimen taken or preserved for the purpose of extracting and analysing DNA in…
Q: Write the sequences of the two 12-residue primers that could be used to amplify the following DNA…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: The restricition EcoRI cleaves double-stranded DNA at the sequence 5'-GAATTC-3' the restriction…
A: The restriction enzymes cuts specific sequence on double stranded DNA molecule and they are used in…
Q: If the Hinfl restriction enzyme recognizes G^ACTC sites, as seen in the image, belUW. GACTC How many…
A: The cloning of DNA is the mechanism by which a certain fragment of DNA is multiplied. The selected…
Q: An E. coli genomic DNA fragment is run out on a gel undigested (U), and then with two different…
A: Restriction enzymes are those enzyme which recognise a specific recognition site in DNA and cuts the…
Q: A molecule of double-stranded DNA that is 5 million base pairs long has a base composition that is…
A: The types of nucleotide bases of the genetic material are the same in all the species present on…
Q: The partial sequence of one strand of a double-stranded DNA molecule is5′ – – –…
A: Restriction enzymes also called molecular scissors are originally a part of a bacterial defence…
Q: Restriction sites are palindromic; that is, they read the same in the5' to 3' direction on each…
A: Restriction enzymes also called molecular scissors are originally a part of a bacterial defence…
Q: When lambda DNA is cut with HinDIII what is the size in base-pairs of the smallest restriction…
A: Restriction enzyme cuts the DNA at specific recognition site. These are palindromic in nature.
Q: Table 1 shows a list of restriction endonucleases with their recognition sequence and the sites of…
A: Restriction enzymes are those that cleave the double stranded DNA at specific site. They have…
Q: Which of the following single-stranded DNA molecules may possibly be a restriction enzyme target cut…
A: Restriction enzymes are specific endonuclease that are responsible for cutting double standard DNA…
Q: Entire sequence below needs to be amplified by PCR and subcloned into a plasmid vector. Which of the…
A: PCR, or the polymerase chain reaction, is a technique used by molecular biologists to amplify…
Q: Which of the following sequences in double-stranded DNA is most likely to be recognized as a cutting…
A: Restriction enzymes are also known as molecular scissors because they cut the DNA at specific, short…
Q: If a mutation that alters EcoRI site 1 occurs in this piece of DNA, how will the banding pattern on…
A: The restriction enzyme is a protein that identifies a specific nucleotide sequence and cuts the DNA…
Q: Which of the following is true about restriction endonucleases?a) Type I and II requires ATP to move…
A: Restriction endonucleases are the specific DNA sequences that cleaves the sugar-phosphate backbone…
Q: A linear DNA fragment was produced by digestion with the restriction enzyme, Xba1. This fragment…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…
Q: The following DNA fragment shows where a number of restriction endonucleases cut sites occur within…
A: Restriction endonuclease Restriction endonucleases also called restriction enzymes are defined as…
Q: The double stranded DNA sequence of a restriction enzyme cut site is typically complementary,…
A: Restriction enzymes are those enzymes which cut DNA by recognizing target sequences. Restriction…
Q: FIGURE 2 shows the only suitable DNA restriction site in a plasmid DNA vector that can be cleaved.…
A: Restriction enzymes are the most important tool in genetic engineering. These enzymes have the…
Q: Restriction mapping of a linear piece of DNA reveals the following EcoRI restriction sites. EcoRI…
A: Introduction By cleaving the internal covalent bonds between nucleotides, endonucleases breaks down…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Given the DNA sequence of the restriction enzyme: gi|6329444|dbj|AB034757.1| Hynobius retardatus mRNA for larval beta-globin, complete cds GCAGAATCTGACTCAAGAAATCCCTCCTCACCCAACACCACCAGCAGCCATGGTTCACTGGACAGCAGAGGAGAAGGCAGCCATCAGCTCTGTGTGGAAGCAGGTGAACGTGGAGAGCGATGGACAGGAGGCCCTGGCCAGGTTGCTGATCGTCTACCCCTGGACCCAGAGATACTTCAGCTCTTTTGGGGACCTGTCGAGCCCAGCTGCCATTTGTGCCAACGCCAAGGTCCGTGCCCATGGCAAGAAGGTCCTGTCCGCCCTGGGAGCCGGCGCCAACCACCTGGATGACATCAAAGGCAACTTTGCTGATCTGAGCAAGCTTCACGCAGACACACTCCATGTGGACCCCAATAACTTCCTGCTCCTGGCAAACTGCCTGGTGATCGTCTTGGCCCGCAAGCTGGGAGCCGCCTTCAACCCTCAAGTCCATGCGGCCTGGGAGAAGTTCCTGGCCGTCTCCACCGCGGCTCTGTCCAGAAACTACCACTAGAGACTGGTCTTTGGGTTTAATTCTGTGAACGTCCCTGAGACAAATGATCTTTCAATGTGTAAACCTGTCATTACATCAATAAAGAGACATCTAACAAAAAAAAAAAAAAAAAAAAAAAAAA Identify two blunt-end cutters Identify two sticky-end cutters. For each, Provide the sequence of the Restriction enzyme, Highlight using a specific color where the DNA sequence where the restriction enzyme will cut the DNA Indicate the…After restriction enzymes cut, they contain unpaired bases. Type II restriction enzymes leave ends that may be 5' overhanging, 3' overhanging, or blunt. In all cases each end is left with a 3' OH and a 5' phosphate. All blunt ends, and any complementary overhanging ends may be re-ligated with T4 DNA ligase, as long as at least one 5'- phosphate is present. In the tables below G^AATTC means that the end after cutting with enzyme will be: -----G 3' -----CTTAA 5' GTGCA^C means that the end will be: -----GTGCA 3' -----C 5' Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang? AccI GT^CGAC BamHI G^GATCC ClaI AT^CGAT NsiI ATGCA^T PstI CTGCA^G BglII A^GATCT TaqI T^CGAThe partial sequence of one strand of a double-stranded DNA molecule is 5'-GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG -3' EcoRI is a restriction enzyme that cleaves after G in the sequence 5'-GAATTC-3'. PstI is a restriction enzyme that cleaves after A in the sequence 5'-CTGCAG-3'. Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The first strand of your duplex DNA fragment should be derived from the given strand sequence. 5'- -3' 3'- -5'
- A linear DNA fragment was produced by digestion with the restriction enzyme, Xba1. This fragment with XbaI(X) sites on both ends was then further digested with HindIII (H) and EcoRI (E). Draw a restriction map of the linear fragment based on the gel electrophoresis results shown below. X H Marker E H/E __2000bp __ __1500b __1300bp __ __ __1000bp __ __700bp __ __500bp __400bp __300bp __ __200bp __ __ __100bpTable 21.3 describes the cleavage sites of five different restrictionenzymes. After these restriction enzymes have cleaved the DNA, four of them produce sticky ends that can hydrogen bond with complementary sticky ends, as shown in Figure 21.1. The efficiency of sticky ends binding together depends on the number of hydrogen bonds; more hydrogen bonds makes the ends “stickier” and more likely to stay attached. Rank these four restriction enzymes from Table 21.3 (from best to worst)with regard to the efficiency of their sticky ends binding to each other.The map of plasmid pUC19 is shown below. The restriction site coordinate is the position of the 5’base on the top strand of each site sequence. The restriction enzyme sites are in bold type if there is only one site in pUC19. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme PvuII. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme DrdI.
- Which of the restriction enzymes listed in the table below produces blunt-end fragments? Enzyme Cleavage site Alul AG|CT Hindll AJAGCTT BamHI G|GATCC EcoRI GJAATTC BgllI A|GATCA Alul O BamHI O Bell O EcoRI O HindlllU have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. PscI & GsuI ______________________________________________________________ ScaI, PdmI & BsaXI ______________________________________________________________ ScaI, SspI & EheI ______________________________________________________________This is a restriction map for the 250 base pair plasmid pSage. Restriction sites for the restriction endonuclease Nhel are 7, 69 and 160. What are the sizes of the restriction fragments produced? Check all that apply. p SAGE Nhel 7 250 bp Nhền 160 Nhel 69 62 69 91 160 97
- Restriction endonucleases are bacterial enzymes that cleave duplex (double-stranded) DNA at specific nucleotide sequences. The mode of replication of the animal virus SV40 has been investigated by using restriction endonucleases that cleave SV40 DNA into a number of unique segments. Like most viruses, SV40 DNA is circular. The map positions of the 11 fragments produced by a pair of restriction endonucleases are shown on the next page. Immediately following a 5 or 10 minute pulse of radioactively labeled thymidine, labeled SV40 molecules that have completed replication during the pulse are isolated. These newly replicated DNA molecules are digested by the restriction endonucleases and the resulting fragments are analyzed for the relative amounts of pulse label they contain. The results are in the table below. Assume that at the time the label was added there was a random population of replicating SV40 DNA molecules in all possible stages of synthesis. From the information given below,…The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given aboveThe following image will be used to answer questions 1 through 9. Below is a restriction map of the circular plasmid YIP5. This plasmid contains 5,541 base pairs. There is an EcoRI site at base pair 1. The locations of other restriction sites are shown on the map. The numbers after the enzyme names tell at which base pair that enzyme cleaves the DNA. If you digest YIP5 with any one of the listed restriction enzymes you will end up with a linearized piece of DNA that is 5,541 base pairs long. EcoRI 1/5541 HindIII 32 Pvul 4916 Eagl 942 YIP 5 Apal 2035 Pvull 3247 Smal 2540 Reaction B) You digest YIP5 with two enzymes, Hindll and Apal, at the same time. How many DNA fragments would you expect from this reaction and what are the sizes of the fragments?