The amino acid at the β82 position is in the central cavity that binds 2,3-bisphosphoglycerate in the deoxygenated form of hemoglobin. How would the mutation of Lys to Asn affect the ability to bind to 2,3-BPG?   a. It would have no effect.   b. It would have decreased 2,3-BPG binding.   c. It would have increased 2,3-BPG binding.   d. It would have increased 2,3-BPG binding at least two fold.

Q: Molecular genetic studies are performed on a family with known familial hypercholesterolemia. In…

A: The question is asking about the likely effect of a mutation in the LDL receptor gene, specifically…

Q: When human hemoglobin undergoes a mutation, the mutant protein usually does not replace all of the…

A: The cytosol of red blood cells contains the oxygen-carrying globular protein hemoglobin, which is…

Q: Sickle cell anemia is caused by a point mutation in the β-globin chain of hemoglobin. Glutamic acid…

A: Introduction : Haemoglobin is a tetrameric proteinmade up of 2 alpha subunits and 2 beta subunits…

Q: What are the primary structures of TATA-binding protein (for ex. letter amino acids),  What are the…

A: TATA-binding proteins (TBP) bind to Sequences on DNA called TATA boxes. TBP is a general…

Q: When bacteria are grown in the presence of high concentrations of tryptophan: O A. A repressor is…

A: Tryptophan is defined as an alpha-amino acid utilized in the biosynthesis of proteins and cannot be…

Q: Based on the principles of RP-HPLC, which sub fraction in the figure (P1 to P8) is the most polar?…

A: HPLC (High Performance Liquid Chromatography): This method is used for protein purification. Here…

Q: After the initial Actualization of the Cit+ phenotype, there was another alteration to the A-3…

A: Bacteria are dynamically evolving microbes. Various experiments suggest the evolution process of…

Q: synaptic knobs of a nueron have what function? a. they release neurotransmitter into the synaptic…

A: The nervous system is the specialized system that controls the sensory and motor activity in the…

Q: Sickle cell anemia patients suffer from a distorted red blood cell shape and an anemic condition as…

A: d. In sickle cell anemia patients, 100% of the hemoglobin assembled contains the mutant β globin,…

Q: O a. N-acetyl-galactosamine and N-acetyl glucosamine O b. D-galactose and N-acetyl glucosamine Oc.…

A: The blood groups are defined by the presence of specific carbohydrate sugars on the surface of red…

Q: Mature human insulin is synthesized from a single Gene but contains two polypeptide chains (A and B)…

A: Introduction Pancreas is a holocrine gland present in our body. It has both endocrine and exocrine…

Q: Predict how the mutation in the seventh codon of normal hemoglobin changing it from ctc to act,…

A: The change of the codon from CTC to ACT is a point mutation at the seventh codon of haemoglobin.…

Q: The melatonin receptor exists in different isoforms: MT1, encoded by MT-1 gene and MT2, encoded by…

A: The DNA is a double stranded nucleic acid that contain 4 types of nitrogenous bases that are adenine…

Q: One of the treatments for sickle cell anemia is hydroxyurea, which is known to induce the expression…

A: The most important mutation is the third one where serine replaces histidine. Whereas histidine is…

Q: Jack is applyng to Gate's foundation for a grant to make a high affinity, humanized monoclonal…

A: Jack is requesting funding from the Gates Foundation to develop a high affinity, humanized…

Q: somatic tumors cause local regions in their vicinity to have an increased pOH, how is this strategic…

A: The T state or the tensed state of  hemoglobin is that of deoxy hemoglobin, that is, when it is not…

Q: The codon change (Gly-12 to Val-12) in human rasH that convertsit to oncogenic rasH has been…

A: The codons are the triplet sequences of the nucleotides like DNA (deoxyribonucleic acid) and RNA…

Q: What is the basic recognition motif to which a N-linked glycan is added? A.S/T-X-X B.KDEL…

A: Introduction N-linked Glycosylation (NLG) Is A Complicated Biosynthetic Process That Controls…

Q: What would be the effect of a drug that altered the structure of allolactose so that it was unable…

A: Lac operon is defined as an operon which is required for the metabolism and transport of lactose…

Q: Jack is applyng to Gate's foundation for a grant to make a high affinity, humanized monoclonal…

A: Jack is requesting funding from the Gates Foundation to develop a high affinity, humanized…

Q: Which of the following are characteristics of “small” monomeric Ras GTPases?     A. Membrane…

A: Answer : The correct option is C because, RAS protein  RAS proteins are small group of GTPase which…

Q: Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute…

A: Acute myeloid leukemia is a disease that interferes in the production of normal blood cells. It is a…

Q: Certain individuals with mild forms ofβ-thalassemia produce, in addition to normal adulthemoglobin…

A: Haemoglobin lepore is defined as a small group consisting of structurally abnormal haemoglobins…

Q: photo-active platinum-based anticancer drugs

A: A group of therapeutic medications known as photo-active platinum-based anticancer therapies rely on…

Q: Given below is the electrophoretic profile of 2 proteins, a normal hemoglobin, HbA and the fetal…

A: Protein electrophoresis is a method that separates proteins based on their size and the electrical…

Q: Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute…

A: Acute myeloid leukemia (AML) is a kind of blood cancer.

Q: Why are leptin injections less helpful for most overweight people than for mice with a mutation in…

A: Appetite refers to the general desire for food intake in an individual. It regulates energy intake…

Q: What will be the effect of the following changes to the protein structure of hemoglobin and its…

A: Hemoglobin is an oligomeric, allosteric, conjugated protein with four polypeptide chains. It…

Q: Jack is applyng to Gate's foundation for a grant to make a high affinity, humanized monoclonal…

A: An antibody known as a monoclonal antibody (mAb) is produced by cells in the immune system that…

Q: Comment on the difference in expression patterns between APETALA1 and CYCLIN1. How do the…

A: The genes are responsible for the expression of characters. There are two types of characters:…

Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…

A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…

Q: Define the following terms: a. intrinsically disordered protein b. intrinsically disordered region…

A: Note: Since you have posted a question with multiple subparts, we will solve the first three…

Q: The NFAT family is a ubiquitous family of transcription factors. a. Under resting conditions, where…

A: a. Under resting conditions, NFAT (Nuclear Factor of Activated T cells) is phosphorylated and…

Q: Consider a bacterial strain that has a mutant lac repressor that cannot bind the operator. A. What…

A: Operon is a group/cluster of genes in prokaryotes that codes for functionally related proteins.…

Q: Some are unable to taste thiourea and PTC. DNA sequence results for these individuals show a normal…

A: Taste is governed/controlled by numerous or multiple genes, some of which may be easily tasted, such…

Q: 1. "Interferons (IFNs)‐α and ‐β are expressed in response to a virus infection and are released from…

A: Interferons inactivates protein synthesis in cells to block the viral replication.

Q: Based on the data provided, explain how cellular processes must be altered in stomach cancer cells…

A: In comparison to healthy cells, cancer cells have an active metabolism and need more energy. Cancer…

Q: Wilms tumor 1, or nephroblastoma, is caused by mutations in the WT1 gene, which encodes a…

A: Molecular biology is an emerging field which focuses on the molecular basis of all biological…

Q: What is an example where p27 kip1 can remain in the nucleus performing its inhibitory effect? A.…

A: INTRODUCTION Mitogen-dependent progression through the primary gap phase (G1) and initiation of DNA…

Q: Select the statement(s) that is(are) NOT true about isozymes   a. Isozymes catalyze different…

A: Proteins that catalyze biochemical reactions in a cell are called enzymes. They affect the rate of…

Q: 1) The plot to the right shows the Oxygen Saturation of Hemoglobin (Hb) versus O2 concentration.…

A: Oxygen saturation is a measure of how much hemoglobin is currently bound to oxygen compared to how…

Marine Evolution

Marine habitat is less explored, and hence, its biological diversity is far less known. The marine habitats are not constant due to their shifting nature, while the terrestrial habitats are more stable. Marine biology is the science that deals with the study of diverse marine species, their interactions, and behavioral characteristics.