Table 18.2 Characteristics of some common type II restriction enzymes used in recombinant DNA technology Microorganism from Type of fragment Enzyme which enzyme is isolated Recognition sequence end produced BamHI Bacillus amyloliquefaciens 5'-GGATCC-3 Cohesive 3'-CCTAGG-3' EcoRI Escherichia coli 5-GAATTC-3 Cohesive 3-CTTAAG-5 EcoRII Escherichia coli 5-CCAGG-3' 3'-GGTCC-5' Cohesive Haelll Haemophilus aegyptius 5'-GGCC-3' 3'-CCGG-5 Blunt HindIll Haemophilus influenzae 5-AAGCTT-3' 3'-TTCGAA-5' Cohesive Notl Nocardia otitidis-caviarum 5-GCGGCCGC-3 Cohesive 3-CGCCGCG-5 Pstl Providencia stuartii 5-CTGCAG-3' 3'-GACGTC-5' Cohesive Smal Serratia marcescens 5-CCCGGG-3' Blunt 3'-GGGCCC-5'

Table 18.2 Characteristics of some common type II restriction enzymes used in recombinant DNA technology Microorganism from Type of fragment Enzyme which enzyme is isolated Recognition sequence end produced BamHI Bacillus amyloliquefaciens 5'-GGATCC-3 Cohesive 3'-CCTAGG-3' EcoRI Escherichia coli 5-GAATTC-3 Cohesive 3-CTTAAG-5 EcoRII Escherichia coli 5-CCAGG-3' 3'-GGTCC-5' Cohesive Haelll Haemophilus aegyptius 5'-GGCC-3' 3'-CCGG-5 Blunt HindIll Haemophilus influenzae 5-AAGCTT-3' 3'-TTCGAA-5' Cohesive Notl Nocardia otitidis-caviarum 5-GCGGCCGC-3 Cohesive 3-CGCCGCG-5 Pstl Providencia stuartii 5-CTGCAG-3' 3'-GACGTC-5' Cohesive Smal Serratia marcescens 5-CCCGGG-3' Blunt 3'-GGGCCC-5'

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter17: Metabolism: An Overview

Section: Chapter Questions

Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...

See similar textbooks

Similar questions

Competent E. coli cells were transformed with the pGLO plasmid. These transformed cells were then allowed to grow on two different plates: 1) a plate containing LB/AMP and 2) another plate containing LB/AMP/ARA. In which plate would you observe both phenotypic and genotypic changes? Briefly justify your answer. Edit View Insert Format Tools Table 12pt v Paragraph v BIUA e T?v 田 D2
Synthetic polylinker Hindill EcoRI sticky end 5 AATTCCTGCAGAAGCTTCCGGATCCCCGGG CITAA Plasmid cloning vector (cleaved with Eco) GGACGTCTTCGAAG GCC TAGGGG CCCTTAA AATTC Psti Hindi Nelson & Co, Leninger Principles of Biochemistryde ©2021 WH Freeman & Company BamHI Smal EcoRI sticky end Enzyme Polylinker transferase; 2 ligase; 6 lyase; 6 lyase; 4 ligase; 4 BamHi Smal CITAAG GRATT C EcoRI Which pairing correctly matches the enzyme class and Enzyme Commission number for the enzyme that catalyzes this reaction?
Using the data in Table, identify restriction enzymes that (a) produce blunt ends; (b) recognize and cleave the same sequence (called isoschizomers); (c) produce identical sticky ends.
Create the restriction map for the plasmid below:
Use the gel to answer the following questions. You will be constructing a map of the plasmid, pDiddy. What is the smallest fragment size that the NcoI/EcoRI double digest produces?
The DNA polymerase used in PCR is taken from Thermus aquaticus, a bacterium that thrives in the extremely high temperatures of hot springs. Why is it necessary to use special DNA polymerase? * bers erences QOnline Thermus aquaticus is accustomed to efficient replication. wsela Thermus aquaticus can survive at boiling and freezing temperatures, both of which are necessary during PCR. ation ogy Periods 1 and 2 "Normal" DNA polymerase would denature in the high temperatures used in PCR. ng periods chool MP1, Highschool Highschool MP3, school MP4 Thermus aquaticus is able to supply a varied amount of bases to the DNA template. tion ting days n Tue Wed Thu Fri Mutations occur randomly during the process of gene expression or by exposure to mutagens. While some mutations are detrimental, others can create proteins that ha n nociti e conahilition In vder fo ra mutation te be n esed tn futuen INTL
What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
Use the gel to answer the following questions. You will be constructing a map of the plasmid, pDiddy. What is the largest fragment size that the BamHI/NcoI double digest produces? 2.250 kb 2.500 kb 2kb 750 b
Map of pUC18 is shown on the here. Describe how to select recombinant clones if a foreign DNA is inserted in to the polylinker site of pUC18 and then introduced into E. coli cells.. Hindll Sphl Sbfl Pstl BspMI Acci Hincli Sall Xbal BamHI Aval Smal Xmal Acc651 Kpnl Banll Eco53kl Sacl Apol ECORI lacz MCS LacR binding site Plac PUC18 Amp 2686 bps PMB1 ori
See image
How many fragments and how big each fragment should be after digesting the plasmid with BamHI? How many fragments and how big each fragment should be after digesting the plasmid with PvuI? How many fragments and how big each fragment should be after digesting with both enzymes? Show your calculation/explanation.
Identify and explain steps ‘A’, ‘B’ and ‘C’ in the PCR diagram given below. Please elaborately explain the answer properly and kindly relate to the NCERT Bio XII chapter 11.