Suppose you were interested in generating a PCR amplicon including the bracketed sequence below. Which of the following sequences would be capable of both yoridizing (annealing) with the target AND would also serve to generate a copy of the bracketed region of interest? S'-AATCGT[AGCAGCAGCAGTGGCT] A AGCT-3" 3' -TTAGCA[TC GT C GT C GTC ACC G A] TTCGA - 5' 3-7TAGC-5 SAATCG-3 S-AAGCT-3 S-AGCTT-3 5-GCTAA-3 5-TCGAA-3

Q: You have isolated a cDNA clone encoding a protein of interest in a higher eukaryote. This cDNA clone…

A: cDNA  It is known as complementary DNA and made up of reverse transcription of mRNA.

Q: What would three possible reasons be that a PCR wouldn't work after cloning a TAQ sequence into a…

A: Even though you've verified Taq protein expression through SDS-PAGE, your PCR might still fail for a…

Q: Your company has decided to develop a PCR test that will be used to determine Huntington's disease.…

A: The polymerase chain reaction (PCR), is one of the most useful molecular biology techniques used to…

Q: please list all possible products in a sequencing reaction using ddGTPA as a terminator based on the…

A: Ans: Chain termination sequencing: It is sanger sequencing method developed by Frederick sanger. The…

Q: Your graduate advisor asks you to amplify the following sequence of DNA by PCR:…

A: The primer should be complementary to the region of template to be amplified.

Q: Design PCR primers for the DNA sequence given below and explain your choice. As part of your answer,…

A: It is a Polymerase Chain Reaction, which is a mechanism for multiplying a specific piece of DNA…

Q: Above what amplicon size is this PCR reaction dNTP limited? The reaction contains 35 pmoles of each…

A: The polymerase chain reaction (PCR) is a relatively common technique that amplifies a DNA template…

Q: In a random sequence consisting of equal proportions of all four nucleotides, what is the average…

A: Restriction enzymes are natural occurring enzymes which are mainly found in prokaryotic organisms. A…

Q: PCR primers Below is a 300 base pair fragment of DNA. The top strand is written in the 5' to 3'…

A: The PCR is known as a polymerase chain reaction in which the DNA template is amplified with the help…

Q: 1 tctagagtca tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca…

A: Forward Primer:5'-TCTAGAGTCAATGAAACAACA-3'Explanation:This sequence starts with the same…

Q: 2) The partial coding sequence of the Spike protein for SARS- COV-2 is shown below: You are tasked…

A: The answer is option A  In the PCR amplification, two primers are used to flank the target region to…

Q: A virus with a circular double-stranded DNA chromosome contains approximately 10,000 bp. You want to…

A: To construct a map of the viral chromosome based on the cleavage sites of the restriction…

Q: You plan to clone exon 11 of the HEXA gene (Section C) into the multiple cloning site (MCS) of the…

A: Answer well explained above

Q: A circular plasmid of 10,000 base pairs (bp) is digested with two restriction enzymes, A and B, to…

A: in agarose gel electrophoresis we separate DNA bands based on their size.

Q: The following illustrates a jagged double-strand DNA break resulting from Cas9 cleavage that…

A: "Investigating the results of DNA repair through non-homologous end joining (NHEJ) following Cas9…

Q: When circular DNA is sequenced, the nucleotide base pairs are numbered starting from a fixed…

A: It is related to molecular biology in which we use restriction enzymes an important tool for

Q: STEP BY STEP Exaplanation would be appreciated so I can understand for upcomming exam. In humans,…

A: Given that  GG =570 GT = 297 TT =33  Total population = 894

Q: Using the plasmid map of pBCH2.0 calculate the length of the shortest DNA fragment if this plasmid…

A: DNA- is a deoxyribonucleic acid, made out of two polypeptides.  Polypeptides are made from four…

Q: The structure of a typical pUC19/human DNA recombinant clone. Ensure that you clearly indicate the…

A: Plasmid vectors are circular and extra chromosomal DNA which are capable of self-replication.…

Q: Below is a portion of an exon from a gene that encodes protein Y in the genome of the plant…

A: Ans 1 :  Yes, there is a mutation in third codon when counting from 5/ to 3/ on template strand in…

Q: Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR…

A: Polymerase chain reaction (PCR) is a method used to  make millions of copies of a specific DNA…

Q: You are studying a new plasmid, and you digest the plasmid with three restriction enzymes: Eco RI…

A: The restriction digestion of plasmid DNA by using restriction nucleases is a useful tool in mapping…

Q: Examine the sequence for the DNA fragment below. Your job is to design primers for PCR that would be…

A: A primer may be a brief single-stranded nucleic acid utilized by all living living beings within the…

Q: For Pet41 (choose Pet41 a, b, or c as provided in the image) how would you design the primers…

A: I'd be glad to assist you with designing primers for the given gene of interest, but I'm unable to…

Q: How would you write out the sequence for the REVERSE primer if you needed to purchase it for use in…

A: The reason we write the reverse primer sequence in the reverse complement form is to ensure that it…

Q: When using the plasmid shown below for cloning, which restriction enzyme site(s) (all indicated with…

A: A plasmid is a double-stranded DNA molecule that is small and circular in shape.  Bactria and yeast…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: DNA cloning restriction sites are specific DNA sequences recognized and cleaved by restriction…

Q: After characterizing the DNA composition of various cats, you identify a protein-coding gene in…

A: In this scenario, we aim to study the structure of the protein product STRIPES, derived from a gene…

Q: Suppose you have to design two PCR primers, 16 bases in length, to amplify the whole of the 100 bp…

A: Primers are short nucleic acid molecule, that are single stranded in nature and area prerequisite…

Q: 5'-GATTACAATAGGAATTC~~ GAATTCTCGTGACTCCG-3' 3'-CTAATGTTATCCTTAAG~ CTTAAGAGCACTGAGGC-5' Which of the…

A: PCR or polymerase chain reaction is a DNA amplifying technique where a short piece of a gene or a…

Q: The figure below shows the recognition sequences and cleavage positions of three restriction…

A: Restriction enzymes are those that have a tendnecy to cut the strands of DNA straight. This leads to…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: The recombinant DNA technology use plasmid to transfer foreign DNA into the host organism in which…

Q: To generate large amounts of DNA to manufacture gene therapy payloads or to be able to see them on…

A: Specific sequences can be amplified by PCR in order to generate large amounts of DNA to manufacture…

Q: Suppose that you would like to amplify the DNA sequence below by a PCR reaction. Design 8 nucleotide…

A: A primer is defined as the short single-stranded DNA sequence, required in the polymerase chain…

Q: The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product…

A: Agarose gel electrophoresis used to separate DNA according to its molecular weight. On agarose gel,…

Q: Procedure Restriction maps for Lambda DNA Lambda DNA may exist as a linear or circular molecule. The…

A: The restriction enzyme is the restriction endonuclease which recognises and cut at the specific…

Q: Primers designing for epitope tagging: Design forward and reverse primers to amplify the following…

A: Primers should generally have the following properties: 1. Length of 18-24 bases. 2. 40-60% G/C…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.