After characterizing the DNA composition of various cats, you identify a protein-coding gene in tigers called stripes and wish to study the structure of the protein product STRIPES. This requires that you purify recombinant ridges from E. coli. First, the stripes gene must be amplified by PCR and then inserted into an appropriate plasmid for bacterial expression. Such a plasmid is diagrammed below. CAP Binding Site ori Ċ Promoter MCS The restriction sites for Aatll and Kpnl are: Aatll 5'-GACGTC-3' Kpnl 5'-GGTACC-3' Laco (Operator) -Kpnl Aatil The coding strand for the stripes gene is shown below, with start and stop codons in bold. 5'-ATGCAACAGTAGCTGAAGCCCAGTGACACCATCGAAAATGTGAAGGCCAAGATGAGGCTCATCTTTGCAGGCAAGCAGCTG GAAGATGGCCGTACTCTTTCTGACTATGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTGACCGGCAAGACCAATGT GAAGGCCAAGATCCAGGATAAAGAAGGCATCCCTCCCGACCAGCAGAGGGCACTCTTTCTGACTACAACATCCAGAAGGAGTCG ACCCTGCACCTGGTCCTGCTGACCGGCAAGACCATCACTCTGGAGGTGGAGCCCAGTGACACCATCGAAAATCCCGACCAGCAG AGGCTCATCTTTGCAGGCAATCACGCACAGTTAA-3' a. List the primer sequences required to amplify the stripes gene with Aatll and Kpnl restriction sites on the appropriate ends such that it can be cloned into the plasmid above for STRIPE expression. Each primer should be 21 bp in length, including the proper restriction site. b. After molecular cloning and confirming you properly cloned stripes into the vector shown, you transform bacteria with the plasmid and select out bacteria that contain the plasmid. Not you want to these transformed bacteria to express the STRIPES. Under what conditions would we need to grow bacteria transformed with this plasmid so that they express STRIPES? Explain your answer, and be sure to describe the important regulatory regions on the plasmid above and what interacts with these regulatory regions in the conditions you have indicated

Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
icon
Related questions
icon
Concept explainers
Question
After characterizing the DNA composition of various cats, you identify a protein-coding gene in tigers called stripes and wish to study the structure of the protein product STRIPES. This
requires that you purify recombinant ridges from E. coli. First, the stripes gene must be amplified by PCR and then inserted into an appropriate plasmid for bacterial expression. Such a
plasmid is diagrammed below.
ori
CAP Binding Site
من
Promoter
MCS
The restriction sites for Aatll and Kpnl are:
Aatll 5'-GACGTC-3'
Kpnl = 5'-GGTACC-3'
Laco (Operator)
-Kpnl
Aatll
The coding strand for the stripes gene is shown below, with start and stop codons in bold.
5'-ATGCAACAGTAGCTGAAGCCCAGTGACACCATCGAAAATGTGAAGGCCAAGATGAGGCTCATCTTTGCAGGCAAGCAGCTG
GAAGATGGCCGTACTCTTTCTGACTATGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTGACCGGCAAGACCAATGT
GAAGGCCAAGATCCAGGATAAAGAAGGCATCCCTCCCGACCAGCAGAGGGCACTCTTTCTGACTACAACATCCAGAAGGAGTCG
ACCCTGCACCTGGTCCTGCTGACCGGCAAGACCATCACTCTGGAGGTGGAGCCCAGTGACACCATCGAAAATCCCGACCAGCAG
AGGCTCATCTTTGCAGGCAATCACGCACAGTTAA-3'
a. List the primer sequences required to amplify the stripes gene with Aatll and Kpnl restriction sites on the appropriate ends such that it can be cloned into the plasmid above for STRIPES
expression. Each primer should be 21 bp in length, including the proper restriction site.
b. After molecular cloning and confirming you properly cloned stripes into the vector shown, you transform bacteria with the plasmid and select out bacteria that contain the plasmid. Now,
you want to these transformed bacteria to express the STRIPES. Under what conditions would we need to grow bacteria transformed with this plasmid so that they express STRIPES?
Explain your answer, and be sure to describe the important regulatory regions on the plasmid above and what interacts with these regulatory regions in the conditions you have indicated.
Transcribed Image Text:After characterizing the DNA composition of various cats, you identify a protein-coding gene in tigers called stripes and wish to study the structure of the protein product STRIPES. This requires that you purify recombinant ridges from E. coli. First, the stripes gene must be amplified by PCR and then inserted into an appropriate plasmid for bacterial expression. Such a plasmid is diagrammed below. ori CAP Binding Site من Promoter MCS The restriction sites for Aatll and Kpnl are: Aatll 5'-GACGTC-3' Kpnl = 5'-GGTACC-3' Laco (Operator) -Kpnl Aatll The coding strand for the stripes gene is shown below, with start and stop codons in bold. 5'-ATGCAACAGTAGCTGAAGCCCAGTGACACCATCGAAAATGTGAAGGCCAAGATGAGGCTCATCTTTGCAGGCAAGCAGCTG GAAGATGGCCGTACTCTTTCTGACTATGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTGACCGGCAAGACCAATGT GAAGGCCAAGATCCAGGATAAAGAAGGCATCCCTCCCGACCAGCAGAGGGCACTCTTTCTGACTACAACATCCAGAAGGAGTCG ACCCTGCACCTGGTCCTGCTGACCGGCAAGACCATCACTCTGGAGGTGGAGCCCAGTGACACCATCGAAAATCCCGACCAGCAG AGGCTCATCTTTGCAGGCAATCACGCACAGTTAA-3' a. List the primer sequences required to amplify the stripes gene with Aatll and Kpnl restriction sites on the appropriate ends such that it can be cloned into the plasmid above for STRIPES expression. Each primer should be 21 bp in length, including the proper restriction site. b. After molecular cloning and confirming you properly cloned stripes into the vector shown, you transform bacteria with the plasmid and select out bacteria that contain the plasmid. Now, you want to these transformed bacteria to express the STRIPES. Under what conditions would we need to grow bacteria transformed with this plasmid so that they express STRIPES? Explain your answer, and be sure to describe the important regulatory regions on the plasmid above and what interacts with these regulatory regions in the conditions you have indicated.
Expert Solution
steps

Step by step

Solved in 3 steps

Blurred answer
Knowledge Booster
Bacterial genomics
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education