After characterizing the DNA composition of various cats, you identify a protein-coding gene in tigers called stripes and wish to study the structure of the protein product STRIPES. This requires that you purify recombinant ridges from E. coli. First, the stripes gene must be amplified by PCR and then inserted into an appropriate plasmid for bacterial expression. Such a plasmid is diagrammed below. CAP Binding Site ori Ċ Promoter MCS The restriction sites for Aatll and Kpnl are: Aatll 5'-GACGTC-3' Kpnl 5'-GGTACC-3' Laco (Operator) -Kpnl Aatil The coding strand for the stripes gene is shown below, with start and stop codons in bold. 5'-ATGCAACAGTAGCTGAAGCCCAGTGACACCATCGAAAATGTGAAGGCCAAGATGAGGCTCATCTTTGCAGGCAAGCAGCTG GAAGATGGCCGTACTCTTTCTGACTATGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTGACCGGCAAGACCAATGT GAAGGCCAAGATCCAGGATAAAGAAGGCATCCCTCCCGACCAGCAGAGGGCACTCTTTCTGACTACAACATCCAGAAGGAGTCG ACCCTGCACCTGGTCCTGCTGACCGGCAAGACCATCACTCTGGAGGTGGAGCCCAGTGACACCATCGAAAATCCCGACCAGCAG AGGCTCATCTTTGCAGGCAATCACGCACAGTTAA-3' a. List the primer sequences required to amplify the stripes gene with Aatll and Kpnl restriction sites on the appropriate ends such that it can be cloned into the plasmid above for STRIPE expression. Each primer should be 21 bp in length, including the proper restriction site. b. After molecular cloning and confirming you properly cloned stripes into the vector shown, you transform bacteria with the plasmid and select out bacteria that contain the plasmid. Not you want to these transformed bacteria to express the STRIPES. Under what conditions would we need to grow bacteria transformed with this plasmid so that they express STRIPES? Explain your answer, and be sure to describe the important regulatory regions on the plasmid above and what interacts with these regulatory regions in the conditions you have indicated
Bacterial Genomics
The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.
Transformation Experiment in Bacteria
In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.
Plasmids and Vectors
The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.
Step by step
Solved in 3 steps