QUESTION 1 Questions 1-5. Please fill in the blank below with the corresponding structures indicated below in the diagram: Please ignore the fact that the fragments are colored blue and green. The coloration has no significance to this question. Also, please don't forget to answer question 61 1. Leading strand= 2. Lagging strand= 3. A single Okazaki fragment= 4. 3' end of fragment labeled "H"= 5. Replication fork= H E G 6. How many primers are required to replicate all of the DNA fragments in the above diagram (include both lagging and leading strand)?=

QUESTION 1 Questions 1-5. Please fill in the blank below with the corresponding structures indicated below in the diagram: Please ignore the fact that the fragments are colored blue and green. The coloration has no significance to this question. Also, please don't forget to answer question 61 1. Leading strand= 2. Lagging strand= 3. A single Okazaki fragment= 4. 3' end of fragment labeled "H"= 5. Replication fork= H E G 6. How many primers are required to replicate all of the DNA fragments in the above diagram (include both lagging and leading strand)?=

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Question 6-10: Choose the enzyme and match it to its function. Bubble the correct letter on the Zipgrade answer sheet. Primase DNA Polymerase Ligase Helicase Topoisomerase/gyrase а. b. с. d. е. 6. This enzyme starts the replication process with a small strand of RNA that is later replaced. 7. This enzyme removes primer and starts adding DNA. 8. This enzyme joins Okazaki Fragments. 9. This enzyme unwinds the original strands of DNA so they can act as templates. 10. This enzyme prevents supercoiling .
QUESTION 2 The SARS-COV-2 pandemic resulted in the desire to design ELISA assays to either detect antibodies against SARS-CoV-2 protein (previous infection), or detect viral protein (current infection). You plan to express the mutant spike protein variant using the plasmid pictured below as your template. Here's the sequence you want to put in its place: https://www.ncbi.nlm.nih.gov/nuccore/AY429073.1?report=fasta, this is the DNA sequence you're going to buy as a gene block! But you need to add a couple things to it first so it'll get into the plasmid. To do so, you're going to need to remove the current insert (represented by the yellow arrow beginning at position 833-4867). Question: What restriction sites are you going to add at the ends of the gene? Answer can be in nucleotides or the enzyme name. For the first blank fill in the site name/sequence you'd add at the beginning of the gene (5' / C-terminus end) and for the second blank fill in the sequence/site name you'd add at the…
QUESTION 22 During the search for the Cystic Fibrosis (CF) gene the investigators used various criteria to conclude that they had arrived at a segment that represented a gene. Which of the properties below was among the criteria used by the investigators? O A. the presence of sequence palindromes O B. gene-specific restriction maps O C. interspecies sequence conservation O D. polyadenylation signals O E. the presence of AT-rich islands QUESTION 23 A feature common to activation of the myc oncogene by both the Avian Leukosis virus and the chromosomal 8:14 translocation is: O A. loss of the 1st myc exon (E1); initiation of transcription from a start site within the myc intron O B. Initiation of transcription from a strong promoter upstream from the first myc exon (E1) O C.A fusion transcript between an active upstream gene and the three myc exons O D.A DNA deletion that eliminates the transcriptional termination signal from an active upstream gene. O E. Recombination between the myc…
QUESTION 6 To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e).... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 O A. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C O B. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8 OC. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4 Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C O D. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG…
QUESTION 3 You are provided with plasmid DNA at 200ng/uL, 10X restriction digestion buffer, restriction enzymes (1 unit/ul) and water. You want to digest 1.5 ug of plasmid DNA with 1 unit (U) of enzyme in 1X buffer in a total volume of 80 ul. Complete the table below: Solution Stock solution Working solution Volume needed restriction digestion buffer 10X 1X DNA 200 ng/ul 1.5 με enzymes 1 unit/ul 1 unit Water Total 80 μL
Question 11 Which polymerase is responsible for transcribing RNA from a single transcription unit, generating a large transcript that is then processed to yield three types of ribosomal RNA Question 11 options: RNA Polymerase I RNA Polymerase II RNA Polymerase III DNA Polymerase Question 12 RNA splicing requires recognition of which nucleotide sequences at the boundaries of transcribed exons and introns (splice junctions)? Question 12 options: GT–AG TG-CA CT-CG CpG Question 13 Following are the three consensus DNA sequences in introns of complex eukaryotes except: Question 13 options: Splice donor site Splice acceptor site Branch site Initiation site
Question 4
Question 16 The full set of different transcripts expressed by a cell is called Question 16 options: Proteome Genome Transcriptome Glycome Question 17 One of the major drawback of using Microarray over RNA sequencing for high throughput sequence analysis is Question 17 options: allows quantification of transcripts over five orders of magnitude used to identify new transcripts and alternative isoforms RNA-Seq is sensitive and offers a way of profiling transcripts of single cells a significant amount of input RNA is required Question 18 Which of these statements are not true for the DNA libraries: Question 18 options: Genomic DNA libraries are collection of cloned DNA fragments representing the genome from an organism. Genomic DNA is completely (fully) digested with…
Question 11 1. An 9 kb circular plasmid is cut with the EcoRI restriction enzyme, and the reaction products are run on a DNA gel and stained with ethidium bromide. Bands of 1.0, 3.0 and 5.0 kb are seen. 2. When the same plasmid is cut with both the EcoRI and BamHl restriction enzymes (a double digest), bands of 1.0, 1.5, 3.0, and 3.5 kb are seen. From these results, it can be concluded tha v[ Select ] cuts within the BamHI [ Select ] v kb [Select EcoRI
Question 17 3′ CCA addition to tRNAs is necessary to ensure: Question 17 options: correct recognition of the mature tRNA by an enzyme that will covalently link the correct amino acid to the end adenosine correct recognition of the mature tRNA by ribosome proper placement of mRNA on ribosome mRNA translocation to cytoplasm Question 18 The. "S" in 28S, 18S, and 5S rRNAs represent: Question 18 options: Svedberg Unit Solution coefficient Saturation Sublimation coefficient Question 19 The catalytic function of the ribosomes is performed by: Question 19 options: RNA component Protein component 60S ribosome subunit 40S ribosome subunit
QUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.
QUESTION 23 You can introduce precise edits into the genome using Crispr/Cas9 and ) A. ligation B. homology directed repair C. T-DNA transformation D. CpG methylation E. nonhomologous end joining