Problem 3: Nitrous acid causes all possible transition mutations, CT and G A. If the normal sequence of a protein contains a valine residue (val) at a particular place, what new amino acid(s) would most often appear in place of the valine residue as a result of nitrous acid mutagenesis? Use a codon chart.

Q: Please help me with this. *Also Please Note: This is ONE problem set and according to the policy,…

A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: Which of the following steps is NOT used in whole genome sequencing? Select one alternative: O…

A: WGS stands for whole-genome sequencing and is a method for examining complete genomes. Identifying…

Q: RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA, This strand…

A: Transcription is the process of transforming the information of DNA sequences in to the mRNA strand.

Q: please answer remainnig questions too thanks. 1) Missense mutation 1)Deletion in Exon2, causing…

A: Mutations arise when a DNA gene is damaged or altered in such a manner that the genetic message…

Q: I don't get it. I need help to explain to me

A: Mutation can be classified as small -scale or large- scale. In the concerned mutational phenomenon,…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…

A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…

Q: Which example is describing a "nonsense" mutation? O The normal amino acid sequence of a protein is…

A: Nucleic acids are large molecules made up of nucleotides that help to build proteins and to express…

Q: Polypeptide sequences are formed from 20 amino acids. What is the probability that a single point…

A: When a point mutation occurs, one of three things may happen:Due to the mutation occurring in a…

Q: 4.08 ¡Î1.02↑ E E 2.54 H H 1.02 Note: 1.67 = EXON = INTRON E 10.8 kbp 3.94 3.66 E = EcoRI site H =…

A: An RNA transcript or the DNA encoding its introns are non-coding segments that are spliced off…

Q: A. The insertion shifts the reading frame to the right .The deletion frameshifts the reading frame…

A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…

Q: BamHI Haelll Both 10 kb 9 kb 8 kb 5 kb 2 kb 1 kb Figure 2 How long is the original DNA molecule?

A: If it is a closed circular DNA, BamH1  cut it into three fragments of length 10kb 5kb 2kb

Q: Question 39

A: DNA sequencing is the process of determining the sequence of nucleotides (adenine, guanine,…

Q: QUESTION 3 Imagine that you repeat the tRNA Selection experiment with modifications as follows: 1.…

A: Transcription is the process by which the information in the gene is coded into a mRNA with the help…

Q: In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence of the…

A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like helical structure which acts as genetic…

Q: Which of the following terms refer to the case when a mutation results in a partial loss of the…

A: Mutation is an alteration in the DNA sequences of the genome of an organism due to environmental…

Q: Match the following (most appropriate combinations): Gel filteration chromatography Electrophoresis…

A: 1) Gel filtration chromatography - separation of proteins in a column based on size. In this type of…

Q: The IRNA that was in the P site moves into the A site C. The tRNA that was in the A site moves to…

A: The process of protein synthesis is called translation. In this process transfer RNA, messenger RNA…

Q: 37 Transposons in eukaryotes are mechanistically different from bacterial transposons. Yes or no…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: 2. What do you predict would happen if you created-a RNA with an anticodon of 5'-CAA-3' that is…

A: The translation of the proteins takes place as the mRNA having the codons are fitting into the…

Q: QUESTION 9 In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence…

A: Abrupt changes in the DNA sequences are called mutations. these may or may not change the protein…

Q: We are given a random DNA sequence (each of the 4 bases has equal probability of occurring at each…

A: The nucleotide triplet that encodes an amino acid is called a codon. Each group of three nucleotides…

Q: à sequence of eukaryotic DNA containing a hypothetical gene. The base that is first (at the 5' end)…

A: The genetic code is a system of rules that living cells use to interpret the information contained…

Q: 9. A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the…

A: Nucleotides are  the building blocks of nucleic acids that are DNA and RNA. It is made up of sugar…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: 2. A polypeptide for a gene has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The…

A: A mutation is a permanent change in the DNA sequence that makes up a gene. Mutations can have a…

Q: Practice test

A: Mutations in RNA sequence:a. Frameshift Mutation (2 marks):This mutation alters the reading frame by…

Q: A. The insertion shifts the reading frame to the right. The deletion frame shifts the reading frame…

A: DNA is two stranded helical structure which act as template for making of mRNA. It also functions as…

Q: Question 36

A: The word oligo in Oligonucleotide stands for scanty or few. Oligonucleotides are the moieties that…

Q: 7. A portion of a wild-type protein is shown below: -His- Thr- Glu- Asp- Trp- Leu His- Gln- Asp- An…

A: A mutation is a change in the sequence of DNA (or RNA in the case of some viruses) that can alter…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.