Predict the resulting DNA strand in the presence of a mutagen that causes the ADDITION of one Cytosine in the N-terminal of DNA----TAG TAC TAG T  --Normal DNA strand               TAG TAG TAT C       TAG TAT CAG T       CTA TAC TAG T       TAG TAG AGC T

Q: describe the normal role of the component, and choose from the selection the most direct effect of…

A: Mutations are the defective change in DNA. Mutations basically changes the base pair sequence of DNA…

Q: Match the mutation with the correct name. Not all labels are used. Nonsense Mutation Mismatch…

A: Any change in the DNA sequence is known as mutation. Some of the mutations are responsible for…

Q: The MutH protein nicks the newly synthesized strand(Figure 16-23). How does it “know” which strand…

A: DNA mismatch repair (MMR) is a highly conserved biological pathway that plays a key role in…

Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…

A: transcription is the process by which messenger rna is made from dna .

Q: Suppose you have previously located and cloned a human gene on chromosome 2. You now believe there…

A: The genome of an organism is defined as the whole genetic information that is inherited from one…

Q: In the diagram shown below representing a replisome, the portion represented by the letter functions…

A: Ans. The method of DNA replication is a process in which double-strand DNA molecule copying in order…

Q: Is the template strand read in the 5′ to 3′ or the 3′ to 5′ direction?

A: DNA (deoxyribonucleic acid) replication is a semiconservative process where each strand in the…

Q: d. O b. protein coding DNA that is transcribed into RNA and then translated into protein O c.…

A: The non-coding DNA sequences are the part of an organism's genome that doesn't encode amino acid…

Q: The palm domain of a DNA polymerase O contains the catalytic site of the enzyme CIC Site

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: How will this mutation affect the golden retriever puppy?

A: Transcription is the process which makes mRNA from DNA in complementary manner. The A, U, G and C of…

Q: A certain section of the coding (sense) strand of some DNA looks like this: SATGTATATCTCCAGTTAG-3…

A: Alternation of DNA sequence or any other charge in the chromosome shape or number is considered as a…

Q: .  Locate the -10 region hexanucleotide sequence in the following coding strand of DNA.  Indicate…

A: Transcription is a process through which the template strand of the DNA transcribes into mRNA in the…

Q: Which of the three Mut proteins is responsible for ensuring that the mismatched base in the newly…

A: DNA replication is the process in which DNA molecules get duplicated. It includes initiation,…

Q: why H is 5' and E is 3'.

A: DNA replication is the process through which cells make copies of the genome's DNA. A cell must…

Q: The epsilon subunit of DNA polymerase III is responsible for its _______ activity. A-5'---->3'…

A: DNA Polymerase III is an enzyme that is involved in DNA replication and synthesis. It has 3'-5'…

Q: The original wild-type" DNA strand is: 5'-ATGGGACTAGATACC-3'. Which allele is least likely to show a…

A: A DNA mutation is a permanent change in the DNA sequence that can be passed on to subsequent…

Q: 5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription…

A: Introduction :  One of the earliest steps in gene expression is transcription. The transfer of…

Q: pc*00ATAAADDATATAJOTTAA 1. Use the genetic code table and the information in the diagram below to…

A: Gene is a part of the DNA, located on a specific site on the chromosome and has a specific sequence…

Q: xplain how mismatch repair fixes incorrectly matched base pairs.

A: During DNA synthesis, most DNA polymerases use a process is called proofreading to double-check…

Q: Explain why H is 5' and leading strand and E is 3' and laggin strand

A: Nucleic acid serves two major functions: carrying genetic information and messenger to relay the…

Q: Draw a DNA helix opened up to copy a single gene (CAREFUL this is NOT a replication bubble). You can…

A: Transcription is the first of several steps of DNA based gene expression in which a particular…

Q: DNA polymerase occasionally incorporates the wrong nucleotide during DNA replication. If left…

A: In the realm of molecular biology, DNA replication is a highly intricate process, but it is not…

Q: Mutations can be caused by which process?   faulty DNA repair   nondisjunction   base sequence…

A: Mutation is defined as any heritable change in the genetic makeup of an individual. It is a sudden…

Q: A. Diagram a short single strand of DNA 5’ -AA-GG- 3’. Show the chemical structure of the…

A: A nucleotide is the monomer that forms the polynucleotide strand which forms either a DNA or a RNA…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.