In a patient with a constitutively active receptor tyrosine kinase that increases the activity of PI3K, the administration of a drug that increases PTEN expression will likely inhibit tumorigenesis because; Group of answer choices PTEN prevents growth factor binding to RTK PTEN competitively inhibits the catalytic subunit of PI3K

Q: Relative Relative H3/H4 Acetylation Relative H3 Acetylation H4 Acetylation DON -4Kb -3Kb -2Kb -1Kb…

A: DNA is responsible for carrying genetic information in cells. DNA is packaged into condensed form…

Q: What would be the likely phenotypic effect of a mutation in HOTAIR and prevented it from binding to…

A: HOTAIR (HOX antisense intergenic RNA) is a long non-coding RNAs with 6 exons and 2158 nucleotides…

Q: The GA(T>C)A mutation in the Duffy promoter impacted expression of Duffy in the following cell…

A: The promoter is the region where the RNA polymerase binds during the transcription i.e. synthesis of…

Q: Chromatin Immunoprecipitation (ChIP) experiments enable researchers to measure the levels of…

A: LPS (lipopolysaccharide) treatment results in the recruitment of the transcription factor NfkB and…

Q: P₁0 ORF1 t₁ ORF2 ORF3 t₂ The diagram above illustrates an operon that is regulated by the RepR…

A: An operon is a group of genes and the regulatory elements that regulate the expression of those…

Q: List one example of AMPLIFICATION OF SIGNAL during the cell’s response to Hedgehog

A: * Hedgehog signalling pathway is important during embryogenesis to  controll proliferation of tissue…

Q: Quorum sensing controls the expression of virulencein many pathogenic bacteria. Usually, pathogens…

A: Quorum sensing is a type of signaling that works between bacteria present in a region. Bacteria…

Q: If a bacteria cell, that has the lac operon, is metabolizing lactose glucose is absent and…

A: We are answering first question. Pls repost for second question.

Q: Using baker's yeast it is possible to generate point mutations that destroy the kinase activity of…

A: Polyadenylation is a process of adding poly A tail to pre- mRNA.

Q: in a fat cell what is the result of activation of genes by PPAR gamma/activator proteins binding?…

A: Peroxisome proliferator - activated receptor(PPAR) gamma is a  nuclear receptor of subfamily 1,group…

Q: What happens in the patched-smoothened signaling system if the hedgehog is NOT present?  A. In the…

A: A gene is a genetic molecule that is passed down from one generation (parents) to the next…

Q: What determines the conformation of Mediator? TAND 1 O TAFS 6 and 9 interactions with transactivator…

A: Introduction In All Eukaryotes, Mediator Is A Multiprotein Complex That Acts As A Transcriptional…

Q: Of the steps listed below, which problem would take you the longest to realize you had a problem in…

A: Receptor tyrosine kinases are abbreviated as RTKs.They constitute one class of transmembrane…

Q: TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC…

A: Transcription is the process of production of an RNA segment from the strand of a gene sequence. The…

Q: Suppose MYC regulates gene X by recruiting DNA methyltransferases (DNMTS). Which of the following…

A: cis regulatory elements are regions of non coding DNA which regulate transcription of neighbouring…

Q: How would you identify patients whose tumor cells are particularly likely to have a somatic mutation…

A: Somatic mutation takes place in all types of cells in the body except the germ cells. Therefore…

Q: The upregulation of the miR-200 family of proteins will promote mesenchymal-to-epithelial cell…

A: Micro RNAs or miRNAs are known to be involved in the regulation of the growth, development, and…

Q: S-Cdk is likely to be a [Select] The inhibitor of Ras is likely to be a [ Select] < The MAP kinase…

A: Cell signaling is the process by which cells communicate with each other and respond to signals from…

Q: of 16 CAT proteins signal in a manner that is uncommon for signaling proteins that carry out similar…

A: STAT or signal transducer and activator of transcription  proteins are latent cytoplasmic…

Q: Which of the follow general transcription factors contains the protein TBP and binds to TATA box…

A: The correct answer is: a. TFIID TFIID is a general transcription factor that contains the…

Q: In eukaryotes, transcription factor activators bind to their enhancer elements and interact with RNA…

A: Transcription factors These factors are responsible for the process of transcription. These proteins…

Q: The following questions are based on information given below: Puc is a transcriptional target of the…

A: Approach to solving the question: 1. Identify Cell Types: First, we need to identify the different…

Cancer Therapy