Q: Why must the gene be inserted into a vector for it to be cloned?
A: Vectors are carriers of target DNA which are readily used in recombinant DNA technology. The most…
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A: DNA contains the genetic information about the characteristics features of te organism present in…
Q: DNa Mapping using Restriction enzymes lab: We will be aliquoting and delivering 5 μl of enzyme to…
A: A restriction enzyme, also known as restriction endonuclease is an enzyme that cleaves DNA into…
Q: Why is this technique used?
A: All cells must synthesize some proteins for their cellular function. The instruction for protein…
Q: Conserved gene order can be termed asa) Orthologb) Syntenyc) Paralogd) Microarray
A: Gene is the functional unit of heredity that consists of DNA (Deoxyribonucleic acid). The DNA…
Q: You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its…
A: As organisms evolve, their DNA and protein sequences change. According to the molecular clock…
Q: 5. What are the Chargaff's rules? Briefly explain by citing an example.
A: According to Watson and Crick , DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure…
Q: Write down all possible outcomes for template ATGCCTAAGTTTCCCTAT sequencing
A: Deoxyribonucleic acid (DNA) is the macromolecule that stores genetic information. It is present in…
Q: DNA microarrays (gene chips) are only capable of monitoring the expression of one gene at a time. O…
A: DNA microarray ( gene chips) are only capable of monitoring the expression of one gene at a time.…
Q: Mapping is the bioinformatics term used to describe alignment of sequence reads to a reference…
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: Primer design for SLIC cloning and the protocol
A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…
Q: What are "genetic biohackers" in reference to "do it yourself CRISPR kits"? Who is Josiah Zayner and…
A: Introduction A genetic biohacker can steal your DNA information and can use it illegally. This…
Q: Using the new sequencing platforms as examples discuss how DNA sequencing technologies have evolved…
A: Dna sequencing g is highly essential for the researchers and the scientists to understand different…
Q: Polymerase chain reaction is commonly used in the laboratory for a) reverse transcription Ob) DNA…
A: In biological and medical research centers, The polymerase chain reaction (PCR) is a frequent…
Q: rue for Sequence tagged site (STS) markers: e mapped by fluorescence in situ hybridization (FISH)…
A: sequence-tagged site (or STS) is a short (200 to 500 base pair) DNA sequence that has a single…
Q: You are cloning a gene from a eukaryotic organism into a plasmid to produce a recombinant protein in…
A: The biological process by which naked DNA (deoxyribonucleic acid) gets transferred from one…
Q: Chromosomal walking is a method of in which researcher begins at a…
A: Chromosomes are long thread-like structures that carry coded genetic information in the form of DNA.…
Q: Please ASAP. Thank you. What is the mechanism of action for CRE recombinase in the CRE-loxP system
A: Cre recombinase is tyrosine based enzyme and is derived from P1 bacteriophage. It uses topoisomerase…
Q: Create a 75-nitrogenous base long DNA and replicate it completely. Make sure initiation, elongation…
A: Introduction The process of replicating a double-stranded DNA molecule into two identical DNA…
Q: What is not true for Sequence tagged site (STS) markers: cannot be mapped by fluorescence in situ…
A:
Q: If companies like 23 and me should be allowed to sequence your DNA and give you the results instead…
A: 23andMe is a privately held personal genomics and biotechnology company based in Sunnyvale,…
Q: Molecular Cloning What does molecular cloning mean (with figures/narratives) How does molecular…
A: A) Molecular cloning is a bunch of trial techniques in molecular biology that are utilized to gather…
Q: Using the GeneEx Computer Simulation http://intro.bio.umb.edu/MOOC/jsGX/JsGenex_C2.html Complete the…
A: A gene consists of : Promoter, exons and introns. In the question, we have to create a hypothetical…
Q: in your word, identify one difference one similarity between 16 S sequencing and metagenomic shotgun…
A: With the advancements in science, different techniques have emerged to sequence the genomes of…
Q: 3. Primer Design You are analyzing the
A: Primer is a short stretch of oligonucleotide which is designed to copy the gene sequence of interest…
Q: Describe the main technique for amplifying a segment of DNA (like the one you suspect is involved in…
A: Polymerase chain reaction is a method used to make several copies of a specific target DNA.
Q: EXPERIMENT #4: POLYMERASE CHAIN REACTION Purpose: Using PCR technique, amplify the region of…
A: PCR- polymerase chain reaction is defined as the process of amplification of the fragments of the…
Q: 汽 (0 hope this picture, https://www.phys.kSu.edu/gene/photos/sd.html. 2 will help you imagine the…
A: Isolation is a microbiological technique in which individual bacterial colonies are separated from a…
Q: Arslan sequenced a gene in lab how he will know about the gene either it is novel discovery or gene…
A: Different techniques are available to identify genes and classify them as novel. Their…
Q: Technique whereby inserting DNA into a clone is accomplished using two different restriction enzymes
A: Directional cloning is the technique which is accomplished by cleaving the plasmid vector with two…
Q: What molecule is next generation sequencing analyzing? DNA, RNA, or protein
A: What is next generation sequencing? It is the process of massive parallel sequencing of DNA…
Q: • High-throughput technologies allow parallel sequencingof millions of individual DNA molecules.…
A: High throughput methods are used in cell biology. Cell biology is a division of biology that deals…
Q: anatomical distribution of gene expression can assessedby...... in situ hybridization rnai…
A: A northern blot is a lab technique for detecting individual RNA molecules in a mixture of RNA…
Q: You have completed an in vitro mutagenesis experiment to create an G to Tmutation in the coding…
A: After first being developed by Frederick Sanger and colleagues in 1977, Sanger sequencing became the…
Q: Of the genes in the microarray shown in the lower part of Figure 20.10, are most overexpressed or…
A: Introduction: Microarray is a technique employed to study the expression of various genes. With the…
Q: CRISPR-Cas9 technology can edit the DNA in random regions True False
A: CRISPR Cas9 technology can edit DNA in precise specific locations and not rand DNA regions. CRISPR…
Q: Genomics and proteomics give us insights into genome function. True False
A:
Q: Im having trouble answering this question. What type of cells can be altered by GETs like CRISPR…
A: The gene therapy or gene editing is an asset for humans, as many of the gene-related disorders can…
Q: Separate the word into their word parts and then define each word part. Mutagen
A: Mutaion is where the DNA or any viral RNA is altered by some external factors which may or may not…
Q: This quarter in lab, you have studied two different technologies that allow genome of a cell:…
A: Scientists have established several methods to edit the genome of a cell. These methods help to make…
Q: You have completed an in vitro mutagenesis experiment to create an G to T mutation in the coding…
A: In molecular biology, sequencing is the most important phenomenon in which the the behaviour and…
Q: Which technique/s is/are used in DNA probe development? O CRISPR O ONA profiling OPOR O DNA…
A: PCR Species-specific probes have been developed. For example, specific DNA fragments specific to A.…
Q: What is the program Finch TV used for? Viewing next generation sequencing data O Opening sequencing…
A: There are so many computer application programs used in bioinformatics to read and interpret the…
Q: Create a 75-nitrogenous base long DNA and replicate it completely. Make sure initiation, elongation…
A: Replication of DNA : DNA replication is the process where a new strand exactly similar to the…
Q: You have been given the DNA sequence for a particular fragment of DNA. You then isolated the mRNA…
A: The correct answer is option b. Deoxyribonucleic acid helix is made up of four nitrogenous bases,…
Q: UCSC Genome Browser on D. melanogaster July 2014 (Gene) Assembly (dm3gene) move » >>> zoom in 1.5x…
A: Exons are the coding region and these exons result in the formation of functional protein or enzyme.
Q: advantages of using larger restriction fragments when constructing a genomic library of human DNA
A: DNA library A DNA library is a collection of cloned DNA fragments containing the gene of interest.…
Q: You have completed an in vitro mutagenesis experiment to create an G to T mutation in the coding…
A: Introduction :- Sequencing is an process of characterizing sequences of biomolecules , particularly…
Step by step
Solved in 2 steps
- Question 32 Enzyme that combines the 2 DNA fragments from different organisms Recombinant DNA Technology Restriction enzymes O Ligase O Palindromic sequencesQUESTION 1 You want to perform PCR on the CDNA of the spike gene from a SARS CoV-2 sample so that you can sequence it. Based on the sequence below, which of the following primer pairs would probably work for PCR of this gene? Spike gene Sequence: 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTT TACTATCCTGATGAAATTTT. .. (it's really long so didn't post the whole thing.).TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTG ATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC - 3' (Tm = 60.5 °C in a standard qPCR mix) Reverse Primer: 5' GGG TGT CAA ATT ACA TTA CAC ATA - 3' (Tm= 59.6 °C in a standard QPCR mix) Forward Primer: 5'- ATG TTT ATT TTC TTA TTA TT -3' (Tm=D 47.2 °C in a standard qPCR mix) Reverse Primer: 5'- GCA AGA ACC ACA AGA GCA TGC ACC -3' (Tm= 68 °C in a standard qPCR mix) Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC -3'…QUESTION 32 Molecular recording involves... O Harvard University A novel way to store large amounts of data OEncoding information into living cells The CRISPR-Cas system All of the abovel
- QUESTION 7 Primers are needed to start a PCR reaction True O False QUESTION 8 Restriction enzymes specifically recognize and cut short sequences of DNA called introns. O exons. O sticky ends. restriction sites. QUESTION 9 The DNA profiles used as evidence in a murder trial look something like supermarket bar codes. The pattern of bars in a DNA profile shows O the order of genes along particular chromosomes O the order of bases in a particular gene O the presence of differently-sized fragments of DNA O the presence of dominant or recessive alleles for particular traits O the number of chromosomes and whether any are damagedQuestion 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3' CTAAGGCATAATGTCGTATCGATATAAGTGCACCATGCGAT 5' Start site Short Answer 140QUESTION 1 In this gel, PCR is performed using primers outside of the repeat area anf the product is then run on a gel. Which of these alleles would be the lowest band and which would be the highest band when run on a gel (remember how electrophoresis works!!) ALLELES #1 -CACACACACACACACACACACACACACACA -CACACACACACACACACACACACACACACACACA # 2 # 3 -CACACACACACACACACACACACACACACACACACA- GENOTYPES 1 2 3 4 5 6. O 1 is lowest band and 3 is the highest band O 3 is lowest band and 1 is the highest band O 1 is the lowest band and 2 is the highest band
- Question 7 (2 points) Determine the matching base pairs that RNA polymerase would lay down for this DNA sequence: TGCAGACT *record your answer with no spaces, dashes, or other charactersQuèstion 34 Enzyme that joins the DNA fragments O Recombinant DNA Technology O Restriction enzymes O Ligase O Palindromic sequencesQuestion 32 What is the difference between an operator and a promoter? Edit View Insert Format Tools Table 12pt v Paragraph v B IUA 2 T?v T²
- Question 16 The full set of different transcripts expressed by a cell is called Question 16 options: Proteome Genome Transcriptome Glycome Question 17 One of the major drawback of using Microarray over RNA sequencing for high throughput sequence analysis is Question 17 options: allows quantification of transcripts over five orders of magnitude used to identify new transcripts and alternative isoforms RNA-Seq is sensitive and offers a way of profiling transcripts of single cells a significant amount of input RNA is required Question 18 Which of these statements are not true for the DNA libraries: Question 18 options: Genomic DNA libraries are collection of cloned DNA fragments representing the genome from an organism. Genomic DNA is completely (fully) digested with…Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTGCACCATGCGAT 5' Start siteQuestion 15 Genomic annotation O requires STSS identifies the location and function of genes Oboth a and b none of the above. A Moving to another question will save this response. Mac 0000