Given below is the electrophoretic profile of 2 proteins, a normal hemoglobin, HbA and the fetal hemoglobin, HbF. What information can be obtained from the profile shown? (+) HbF ww wm (-) HbA A. HbF has a slightly different conformation compared with HbA B. HbF and HbA have different primary structures C. HbF has a higher affinity for oxygen than HbA D. HbF has a nonpolar amino acid residue in place of a basic amino acid. E. HbF has an acidic amino acid residue in place of a nonpolar amino acid

Q: When human hemoglobin undergoes a mutation, the mutant protein usually does not replace all of the…

A: The cytosol of red blood cells contains the oxygen-carrying globular protein hemoglobin, which is…

Q: 15. Denaturation of ß-lactoglobulin is strongly related so many funcitonal proportes of dairy…

A: 15. The effects of beta-lactoglobulin denaturation on the texture and solubility of yoghurt and milk…

Q: Ethylhydroceuprin (optochin) is a specific inhibitor of S. pneumoniae and its mechanism is: a.…

A:

Q: 11. Which of the following best describes what happens when hemoglobin binds bisphosphoglyceric acid…

A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…

Q: A point mutation in Hb diminishes hydrophobicity at the heme. Which of the following impacts would…

A: Hb hemoglobin carries O2 in the blood during the gaseous exchange.

Q: Which ONE of these is TRUE regarding the aetiology of acute lymphoblastic leukaemia (ALL)? Select…

A: in regarding of the aetiology of Acute Lymphoblastic Leukemia (ALL)

Q: 1. Hemoglobin F (HbF), known as fetal hemoglobin, is the predominant hemoglobin in the human fetus…

A: Hemoglobin is a protein found in RBC whose main function is to carry oxygen from the lungs to…

Q: i) A couple each having sickle cell trait have five children. What is the probability that they will…

A: Sickle cell disease (SCD) is a genetic disorder that follows the autosomal recessive pattern of…

Q: 4. You are to choose the members of an expedition that will climb several high mour Each applicant…

A: Hemoglobin abnormalities are referred to as the type of blood disorders that have a major impact on…

Q: ANDOKOLESTEROL 13 14 15 16 << 13 14 15 To unde 20 PLCAT 18 16 A. Chylomicrons remnants B. IDL CapoB…

A: Introduction: Lipoproteins are spherical molecular complexes that contain both lipids and proteins…

Q: 1. Hexokinase (HK) catalyses the conversion of glucose to glucose-6-phosphate. There four distinct…

A: The very first reaction of glycolysis is catalyzed by the enzyme Hexokinase where it converts…

Q: 11. The SARS (SARS CoV-1) virus and Covid19 (SARS-CoV-2) virus both bind to the…

A: The SARS-CoV-2 virus causes coronary artery disease (COVID-19). The majority of persons who are…

Q: 1.Which of the following is not an example of a protein with quaternary structure? a. Calmodulin is…

A: Proteins are unbranched polymers constructed from 22 standard α-amino acids. They have four levels…

Q: Explain the connection between the founder and the G8-C marker.

A: In this example the original mutation that caused  the huntington allele occurred in a germline cell…

Q: What is/are product(s) from commensal bacteria that regulate the expression for ler, regulator of…

A:

Q: 2. Hemoglobin releases protons upon oxygen binding. This phenomenon is called the Bohr effect, and…

A: Introduction Hemoglobin, often known as Hb or Hgb, is an iron-containing oxygen-transport…

Q: Using the AAV virus you created in the simulation, you introduce it to a mouse model for heart…

A: Viruses are minute particles that are made up of only their genetic material which may be DNA or RNA…

Q: 1. Briefly describe the affect of the glutamic acid to valine mutation on the Hemoglobin protein as…

A: Answer

Q: A mutation in the promoter region of the gene for the beta-globin can cause betathalassemia, a…

A: Transcription is the synthesizing of RNA from DNA. Both eukaryotes and prokaryotes are transcribed…

Q: You have been given 5 protein samples of known concentrations (ug ml) for SDS-PAGE analysis: a. Wild…

A: Gel electrophoresis is a technique routinely used in molecular biology laboratories to separate…

Q: The fetal HbF has a higher affinity for oxygen than the mother HbA. What structural features of…

A: Hemoglobin is an iron-containing protein found in all red blood cells (RBCs) and is responsible for…

Q: Thiopurine methyltransferase (TPMT) metabolizes many immunosuppressants such as azathioprine.…

A: Thiopurine S-methyltransferase (TPMT) deficiency is a disorder in which the activity of an enzyme…

Q: . What are two features of Viperin-like enzyme structure that make it different OR similar to…

A: Viperin is a member of the radical S-adenosylmethionine superfamily and has been shown to restrict…

Q: 19) Thalassaemia is a genetic disorder in which the red blood cells in the body cannot carry oxygen.…

A: Given: Thalassaemia is a genetic disorder in which the red blood cells in the body cannot carry…

Q: .HbF is the predominant hemoglobin of embrions.It has two γ-and two α-subunits(α2γ2).HbF does not…

A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…

Q: here is a benign congenital condition called Hereditary Persistence of Fetal Hemoglobin (HPFH) in…

A: Hereditary Persistence of Fetal Hemoglobin is the condition when there is still fetal hemoglobin…

Q: 5. (a) Hexokinase IV is known as glucokinase (GCK) and is a central metabolic enzyme that…

A: Hexokinases: An enzyme that phosphorylates hexoses (six-carbon sugars) to produce hexose phosphate.…

Q: What is the chemistry behind of the effect of proteins when it is subjected to different…

A: Proteins are made up of amino acids and these are organic molecules that are susceptible to some…

Q: Match the following protein pair with whther they are orthologues, paralogues or neither.…

A: Homologous genes are those gene that share a common evolutionary ancestor. A pair of homologous…

Q: 5. (a) Hexokinase IV is known as glucokinase (GCK) and is a central metabolic enzyme that…

A: Glucokinase (GCK) , the fourth isozyme version of Hexokinase (hence also called as Hexokinase IV) is…

Q: Shown in the table are partial sequences (coding strand) of the normal human hemoglobin and three…

A: Introduction Hemoglobin, often known as Hb or Hgb, is an iron-containing oxygen-transport…

Q: Of all the genes in the human genome, the ones withthe most characterized Alu insertions are those…

A: Introduction  Transposons are the short highly repeated DNA sequence present in heterochromatic…

Q: 8. Patients on Irinotecan therapy increase production of hCES2 even though hCES2 breaks it down.…

A: To determine the optimum dosage of irinotecan and compound 24 in a patient with chronic diarrhea who…

Q: The fetal HbF has a higher affinity for oxygen than the mother HbA. What structural features of…

A: Bohr effect refers to the shift in the oxygen dissociation curve  towards right caused by changes in…

Q: Number 3. I would say no burn  can’t  explain why’s exactly. IS it right? And how would I explain…

A: Escherichia coli abbreviated as E. Coli is a bacterium commonly found in the digestive system of…

Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…

A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…

Q: Based on the data provided, explain how cellular processes must be altered in stomach cancer cells…

A: In comparison to healthy cells, cancer cells have an active metabolism and need more energy. Cancer…

Q: Which of the following 1-C unit:carrier pairing is/are correct? a.biotin:C02 b.THF:-CH2-…

A: Biotin is a co-factor that carries CO2 and regulates the activities of enzymes like acetyl-CoA…