Which of the following 1-C unit:carrier pairing is/are correct? a.biotin:C02 b.THF:-CH2- c.THF:CHO d.S-adenosylmethionine:-CH3

Q: When human hemoglobin undergoes a mutation, the mutant protein usually does not replace all of the…

A: The cytosol of red blood cells contains the oxygen-carrying globular protein hemoglobin, which is…

Q: Cells, including immune cells, degrade mRNA molecules in which no long open reading frame is…

A: An immune cell is a cell that is part of the body's immune system and will help the body fight…

Q: What in your opinion can the biomedical engineer do to help in the cure of COVID-19?

A: Biomedical engineering is also termed medical engineering. It is the design concept of medicine and…

Q: In fact, immunoglobulin G consists of two identical copies of the heavy chain and two identical…

A: Immunoglobulin (Ig) are also considered as antibodies, which is a glycoprotein. These are produced…

Q: which of these describes the symptoms of the disease(s) caused by mutations in this gene…

A: Mutation in the following gene i.e. XPA gene, causes malfunctioning of DNA repair mechanisms of our…

Q: Retroviruses such as HIV, Herpesviruses, and Hepatitis B can be effectively inhibited by _____. Mark…

A: Nucleoside analogs such as acyclovir are antiviral drugs that can effectively inhibit the…

Q: In order to vaccinate people against diseases by having them eat antigens (such as the cholera…

A: Vaccine is a biological preparation to induce acquired immunity in an individual against a…

Q: Tamayo in one of her experiments seemed to have a cure for Nezuko's demonification. She found out…

A: In the analysis of the reaction kinetics concerning Nezuko Kamado's blood concentration (K), the…

Q: + + T | + + 1 = + T +||| + 2 +11 + 1 + + 1 + + + 1 + + + + 3 4 5 + + I 9 9 5 U 4 m N 1 + - - + + + +…

A: Given here are point mutattions and the correct order is as follows.

Q: Can you please briefly define these five classes of domain folds.: α, β, α / β, α + β, and…

A: On a larger scale based on α and β secondary structures, the classes of domain folds are:- 1. α: In…

Q: We now have at least three SARS-CoV-2/COVID-19 vaccines approved by the FDA for use in the United…

A: The vaccines are: 1. Pfizer-BioNTech – Authorized on December 11, 2020 2. Moderna – Authorized on…

Q: Using the AAV virus you created in the simulation, you introduce it to a mouse model for heart…

A: Viruses are minute particles that are made up of only their genetic material which may be DNA or RNA…

Q: The following compound is: O a. A classical synthetic cannabinoid. O b. A non-classical synthetic…

A: Cannabinoids are naturally occurring compounds found in the Cannabis sativa plant whereas…

Q: Antibodies are effective against bacteria as well as viruses, but some bacteria produce an enzyme…

A: Antibody or immunoglobulin are a molecule that is secreted by the B-lymphocyte cells. It has a…

Q: 100) The HA protein of Influenza vaccine is a. The HA1 is responsible for binding to unexposed…

A: Answer :- Option (B) is correct. - The HA protein of influenza vaccine is the HA protein of the…

Q: Which classification of AML best fits this morphology, immunophenotyping, and cytochemistry? Select…

A: Leukemia is a specific type of blood cancer that is caused due to the abnormal increases in the…

Q: 1. What is the biochemical pathway for tryptophan?…

A: The correct answer for part 1 is B：Precursor-----AA--------GP---------I--------tryptophan

Q: Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute…

A: Acute myeloid leukemia is a disease that interferes in the production of normal blood cells. It is a…

Q: Wearing a face mask, hand hygiene, and social distance); all of these are ways to break the chain of…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute…

A: Acute myeloid leukemia (AML) is a kind of blood cancer.

Q: What will be the effect of mutation that turns lysine to arginine

A: The mutations occur in genomic DNA but they will reflect in the form of protein sequence and…

Q: Which ONE of the following genetic patterns defines a patient with acute myeloid leukaemia with the…

A: Any kind of alteration in the nucleotide sequence of an organism’s genome is referred to as a…

Q: How many of the following proteins can interact homophilically (be involved in homophilic…

A: The multicellularity in organisms was achieved only when the cells were able to recognise and attach…

Q: One of the key biological characteristics of SARS-COV-2, as well as several other viruses, is the…

A: SARS-CoV-2 uses several members of Protein as active antigens. One of the most important is the…

Q: 1) What is an obvious physical difference between an immunoglobulin (an antibody) and glucose (a…

A: Immunoglobulins are also known as antibodies. They are glycoproteins which are produced by white…

Q: Which of the following statements best explains why the immune system can continue to make…

A: Rituximab is a medication that will be mostly used for treating rheumatoid arthritis as well as…

Q: A virus has been identified that encodes a protein which inhibits the transporter-associated with…

A: Transporter associated with antigen processing (TAP)

Q: The immunoglobulin molecules of a particular mammalian species have kappa and lambda light chains…

A: An antibody molecule consists of two primary chains called the heavy chain and light chain and there…

Q: An antibody molecule is made up of four four polypeptides, two light chains and two heavy chains,…

A: The highly variable region of an antibody, also known as the variable domain, is essential for the…

Q: following statements best describes the function of SDS in western blotting?

A: Western blotting is a technique used in molecule research studies to study a specific sequence of…

Q: The best drug target would be: a. ribosomal protein production b. Hemagglutinin-mediated fusion…

A: The best drug target for creating an anti-viral medication active against both H5N2 and H5N1 strains…

Q: You are an extraterrestrial geneticist working at Area 51 to sequence the genome of a recently-…

A: The production of polypeptide chain or protein (made up of amino acids) from the mRNA is known as…

Q: 1. "Interferons (IFNs)‐α and ‐β are expressed in response to a virus infection and are released from…

A: Interferons inactivates protein synthesis in cells to block the viral replication.

Q: Which of the following drugs would you expect would prevent transformation of cells by the Rous…

A: Option D- Reverse Transcriptase Inhibitor-  is the answer

Q: Determine the results of an insertion of TA between positions 2 and 3.

A: 5' GTAGGGAGAACGAGACAATCTG  3' DNA 3' CATCCCTCTTGCTCTGTTAGAC  5'   5'GUAGGGAGAACGAGACAAUCUG 3' mRNA…

Q: One of your patients, a six-year-old girl who suffers from Sickle cell anemia, an inherited blood…

A: When a DNA sequence changes, it can be referred to as mutation. Effect of mutagens, exposure to…

Q: a. What is specific about the ACE2 receptor that makes it easy for the spike protein to bind to it?

A: The coronavirus disease or COVID-19 is an emerging disease spreading all over the world. It is…

Q: ich of the following is NOT a probable mechanism related adiation (UV and ionizing) A. T-T…

A: Finally radiation such as X-rays and UV rays are very harmful for DNA backbone which is made up of…

Q: The tertiary structure of immunoglobulin G is composed of 12 discrete:   A. alpha-helices   B.…

A: Seventy five percent of all antibodies in human serum are of the immunoglobulin G (IgG) type. An…

Q: A study is performed in persons with an immunodeficiency disease in which activation of macrophages…

A: Immuno deficiency disorders are he result of malfunctiong immune system which leads to faster…

Q: Select one: A. It can solidify polyacrylamide gel. B. It allows the transfer of proteins from…

A: A. It can solidify polyacrylamide gel.B. It allows the transfer of proteins from polyacrylamide gel…