appears quite suddenly. How would we best explain the rapid activation of cyclin-Cdk? a. Cyclin-Cdk gene expression leads to rapid protein synthesis. b. All cyclin-Cdk is activated when it exits the nucleus. c. Ubiquination leads to proteolytic activation of the cyclin. d. Positive feedback loops cause its rapid activation. G1 S G2 M

Q: The first step in the action of a growth factor isa. histone unwinding.b. binding to cell surface…

A: Answer is b.) binding to cell surface receptors.

Q: What inhibit CDK activity by bindingdirectly to the cyclin-CDK complex.

A: A cyclin-dependent kinase complex or CDKC or cyclin-CDK is formed by the interaction of a regulatory…

Q: Oncogenes show a of mutation, while tumor suppressor genes show a of mutations. is the process by…

A: Cancer is a group of diseases involving abnormal cell growth with the potential to invade or spread…

Q: When bacteria are grown in the presence of high concentrations of tryptophan: O A. A repressor is…

A: Tryptophan is defined as an alpha-amino acid utilized in the biosynthesis of proteins and cannot be…

Q: What would be the effect on the cell cycle if a cell acquired a mutation that rendered each of the…

A: The cell cycle is a series of events that take place in a cell as it grows and divides. A cell…

Q: (a) Delineate an apoptosis initiated sequence of post-PDI activity in detail. How can tosis…

A:

Q: Which of the following conditions are required for the Eve protein to be expressed in the cells that…

A: Apoptosis is defined as a form or type of programmed cell death that will occur in multicellular…

Q: Match the mutation in the trpL leader sequence with the correct phenotype of the mutant. A. The TRP…

A: Introduction The trp operon is a collection of genes found in E. coli bacteria that code for…

Q: Why do transcriptional regulators act as dimers or heterodimers rather than monomers when binding to…

A: Genome of an organism, especially of eukaryotes, contain large number of non-coding sequences. In…

Q: The transphosphorylation of STAT proteins by Jannus Kinase causes: a. formation of STAT heterodimers…

A: Solution - c is correct option- formation of stat heterodimer which act as transcription factor.

Q: Intracellular signaling can cause rapid changes to the structure of the actin cytoskeleton but is…

A: Cell signalling is the process by which complex biochemical and metabolic processes are conducted…

Q: Please answer problem #3

A: Ligand is a substance that forms a complex with a biomolecule to serve a biological function. In…

Q: Predict the outcome of the following hypothetical experiments and be sure to explain and be rational…

A: Three fictitious studies are given, all of which include medication treatments or molecular changes…

Q: Which of the following molecules is designed to deliver drugs to the body cells? O a. Proteasome O…

A: "Since you have asked multiple questions, according to Bartleby's guidelines we are eligible to…

Q: true or false? And why it is false For the actin cytoskeleton, diverse cell-surface receptors…

A: The Rho family of GTPases is a family of small signaling G-proteins of ~21 kDa that is a subfamily…

Q: Expression of ---- does not require new protein synthesis.     a.immediate early genes b. delayed…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: Indicate which of the following involves osmosis by answering yes or no. Plant seeds soaked in water…

A: Osmosis is basically a spontaneous process where there is a  net movement of water molecules through…

Q: A mutated form of protein p5x is found in patients with squamous cell carcinoma. In vitro studies…

A: A gene that produces a protein that is essential for regulating cell division and death and is…

Q: Define Explain the role of CDK inhibitors. If cyclin-CDK com-plexes are necessary to allow regulated…

A: The cell cycle is an important process occurring in a living cell which is consists of four main…

Q: What function of the microtubule motor proteins dynein and kinesin is blocked by the use of…

A: Dynein and kinesin are two types of proteins that are essential for cell movement. Dynein is…

Q: Oh no! A mutation in the gene for G2 CDK has caused a problem with binding of the G2 cyclin. This…

A: Cell theory states that cell is the structural and functional unit of an organism and all the cells…

Q: cells undergo programmed cell death. Write out the pathway(s), noting the changes (e.g.,…

A: Cell division is a fundamental process in living organisms that allows for growth and tissue repair.…

Q: The Bax protein, thus Select one: apoptosis. a. none of the above b. inhibits caspase activity,…

A: Introduction :  All multicellular organisms, including plants and animals, go through the…

Q: About the role of Ran-GAP and Ran-GEF for the unidirectional transportation of the cargo proteins…

A: Ran is a nuclear protein that is related to RAS and is also known as a GTP-binding nuclear protein.…

Q: Scientists have identified overexpression of Na+/K+ ATPases in several types of cancers plorectal…

A: It is given that we have to design a drug which is preventing the overexpression of the Na+/K+…

Q: The antagonist of the inhibitor in down regulation is called: A. repressor B. promoter C. inducer D.…

A: The antagonist of inhibitor in down regulation is inducer.

Q: 11. You isolated a gene expressed in differentiated hepatocytes in mice. You then fused various…

A: A gene consists of promoter, enhancer, silencer, functional gene, introns ,termination sequences…

Q: 220. Dr. Rose Lees is a world expert on breast cancer. Choose True or False. Of all the receptors…

A: As per Bartleby policy i can solve only first question. The answer of first question - TRUE Cancer…

Q: VHL is a tumor suppressor because     a. it causes cancer cells to become hypoxic     b. it…

A: Tumor is a mass or lump that results from the abnormal growth of cells in the body. A tumor…

Q: During apoptosis, rates of protein degradation activity. Select one: a. decrease, decrease b.…

A: Apoptosis is a process of cell death that is mediated by proteases. Proteases are enzymes that…

Q: 3.3. Using your knowledge of the function of p53, discuss why targeting mutant p53 is promising for…

A: The p53 protein is a tumor suppressor that plays a crucial role in preventing the formation and…

Q: - In some tumor-suppressor genes like p53 and ras-oncogene, oxidative damage has been commonly…

A: p53 could be a tumor suppressor macromolecule that regulates the cell cycle and therefore functions…

Q: Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.Metabolic…

A: Since you have asked multiple questions, we will slove the first question for you. If you want any…

Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…

A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…

Q: lease solve parts E and F

A: Ans E:- The regulation of formation and destruction of cyclins occur at following levels:-…

Q: True or False? p21 inhibits the S-cyclin/S-Cdk complex.

A: p21 is a cyclin-dependent kinase inhibitor that is activated by p53 transcriptionally when DNA…

Q: What is the relationship between cyclin and CDK?

A: Cell cycle is regulated by series of protein complexes. These are composed of two sub units: Cyclins…

Q: E. For the two mechanisms of apoptosis that do require cytochrome c release, which requires caspase…

A: Definition of Apoptosis:  Apoptosis is form of programmed cell death which  begins when a cell…

Q: "Schematic outline of melanogenesis. UVR stimulates the expression of POMC by keratinocytes. The…

A: Melanogenesis is the chemical pathway through which natural pigments known to be melanin pigments…

Q: cancer-associated kinase.

A: Proto-oncogene tyrosine-protein kinase (Src) is a kind of non-receptor tyrosine kinase protein which…

Q: 5. PDGF is overexpressed in certain cancers. This is an example of a mutation in the --- region. a.…

A: INTRODUCTION Answers of question 5&6 is given below.

Q: Deficiency in HGPRT will lead to what? a. No synthesis of ATP b. No salvage pathway for all purines…

A: Hypoxanthine- guanine phosphoribosyl transferase (HGPRT) is required in salvage pathway which is…

Q: The fabrication of 3D printers cellular scaffolds for cancer research. Would this process is viable?…

A: Scaffolding provides structure and support to the cells and subsequently tissues  It helps the cell…

Q: Using M cyclin-Cdk as a specific model describe the different ways it can be activated or…

A: The mitotic (M) phase comprises of mitosis and cytokinesis. Mitosis is the process of cell division…

Q: Consider the nature of cell signaling pathway outcomes. Which of the following is a benign mutation…

A: The correct option is C Results in increased p53 Activity. explanation  In a normal cell there are…

Q: Which molecule(s) is directly activated by Ras-GTP? A. Gene regulatory proteins B. ERK (MAP kinase)…

A: Ras protein belongs to a class of small GTPase protein, which mainly functions in transmitting…