A. Determine the MRNA codons, tRNA anticodons, and amino acid chain that will be produced from the given DNA sequence. 3. TCC-TTG-GGT-GAG-CAT MRNA codons : TRNA anticodons: amino acid chain:

Q: Section B: True / False (5 marks) 1. Primase has a DNA dependent RNA polymerase activity. 2.…

A: True or false statement Primase is a kind of RNA polymerase that is involved in the replication of…

Q: During the transcription of a given portion of a DNA molecule Select one: a. MRNA is synthesized on…

A: Messenger RNA (mRNA) is an RNA sequence that is transcripted from the DNA sequence. This mRNA is…

Q: 8. A type of gene therapy called RNA interference (RNAI) is being investigated to treat Huntington's…

A: During transcription, the DNA double helix unwinds and the RNA polymerase enzyme reads the template…

Q: Please answer fast Give ans for each statement   1.A protein linked to a disease state is being…

A: A protein cause disease if it misfolded and aggregared even though it has same amino acid…

Q: RNAi...  result in product of dsrna or sirna to sirna or mirna! does it increase or decrease…

A: RNA i or RNA interference is a natural process occurs; in most of the eukaryotes;post…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: Date: Class: Name: Transcription Questions Answer the following questions. 1. What bases are found…

A: DNA is the genetic materials of all most all eukaryotes and prokaryotes. RNA is genetic materials of…

Q: . List the sequences of RNA that would be transcribed template sequences. a. Ans:…

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…

Q: Define mutation. Then describe the three basic types of mutation (substitutions, insertions, and…

A: A mutation is an alteration in the DNA sequence that mainly arises during the replication of DNA or…

Q: Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a…

A: A missense mutation is a type of point mutation where a single nucleotide change in the DNA sequence…

Q: 1. Transcribe and translate the mutated DNA sequences, CIRCLE the mutation, and classify each type…

A: The change in the sequence of the genetic material of an organism that results in any heritable…

Q: . What are three differences between RNA and DNA?

A: As per our honor code, We are authorized to answer one question at a time, since you have not…

Q: Identify the term being asked by the statement: a. It describes mRNA that results in a single…

A: The RNA is produced from the DNA by the transcription process and the mRNA is used for the protein…

Q: 7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: a. Show (on the image) 3 steps that must be taken to produce a mature mRNA molecule from this pre-…

A: RNA Splicing: A newly created precursor messenger RNA (pre-mRNA) transcript is converted into a…

Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…

A: transcription is the process by which messenger rna is made from dna .

Q: 1.Describe the journey of a protein, from its synthesis to its final destination 2. Explain the…

A: Proteins are essential macromolecules that perform various functions within cells and organisms. The…

Q: Sickle cell anemia occurs due to a point mutation in a gene for hemoglobin protein. This mutation…

A: Sickle cell anemia occurs due to point mutation in a gene for hemoglobin. Its symptoms are - fatigue…

Q: at is the difference between sickle-cell A sequence and normal DNA sequence? . Normal DNA sequence:…

A: Any abrupt changes in the DNA sequence results in a mutation. This may or may not change the…

Q: 1. Determine what is being meant by each statements: a. It describes mRNA that results in a single…

A:

Q: C. Two mutations are known in the population, one shaded in yellow and one in blue, in the TEMPLATE…

A:

Q: Explain point  mutations and frameshift mutations. Which is more apt to disrupt the  structure and…

A: Proteins are the expression of the information present in the DNA (deoxyribonucleic acid). This…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B |C| D Exons: A, C, D…

A: The process of synthesizing RNA from the genetic information encoded by DNA is called Transcription…

Q: 8. Determine the amino acid chain coded for by the following another A is added after the first…

A: Mutations are the changes in the DNA sequence that may lead to harmful results.Frameshift mutations…

Q: B. Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a…

A: A silent mutation is a type of mutation that occurs in DNA where a single nucleotide is changed, but…

Q: 8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: Mutation can be defined as change in nucleotide sequence of a gene. Based on the type of change,…

Q: following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA…

A: A) The output from the given nucleotide sequence is RYIF which is Arginine>Tyrosine>…

Q: Describe three chemical or structural characteristics of RNA that are different from those of DNA .…

A: Introduction In the cell two types  of nucleic acids are present, i.e. DNA (deoxy ribonucleic acid)…

Q: . In prokaryotes and eukaryotes, describe what else is happening to the RNA while RNA polymerase is…

A: RNA synthesis, which is carried out by RNA polymerase, maybe a basic movement in both prokaryotes…

Q: I. List the sequences of RNA that would be transcribed from the following DNA template sequences. а.…

A: Transcription is the initial stage in gene expression, when genetic information is utilised to build…

Q: D. Fill in the table below. Determine the correct template and coding strands to properly answer…

A: DNA is a double helical macromolecule that has genes that contain the necessary information for the…

Q: .  Locate the -10 region hexanucleotide sequence in the following coding strand of DNA.  Indicate…

A: Transcription is a process through which the template strand of the DNA transcribes into mRNA in the…

Q: Discuss    how    mutations    may    arise    in    DNA,    and    the    potential    consequences…

A: Mutations are the changes in the nucleotide sequence of DNA and it arises at the time of DNA…

Q: C. Two mutations are known in the population, one shaded in yellow and one in blue, in the TEMPLATE…

A: Mutations are changes in the sequence of DNA that arise due to a change of nucleotides, which can be…

Q: 2. Consider the pre-mRNA molecule shown below. Re-order the events listed, in the sequence they…

A: Introduction :  Through transcription process RNA synthesized from DNA. After that RNA processing…

Q: a. As a result of the structure of DNA and RNA, replication, transcription and translation are…

A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…

Q: E channel Charged tRNA Anticodon for START Initiating factors Release factors III III E III = exit…

A: The transition of mRNA into protein is known as translation, and it is a fundamental process in…

Q: utation rates than DNA viruses such as Herpes viruses? olymerases which copy viral RNA have much…

A: Viruses may be either composed of RNA or DNA. The Genome is surrounded by a protein coat called…

Q: G. Aureliano has a mutation in the blue-shaded nucleotide in the TEMPLATE DNA sequence. Instead of a…

A: Introduction :- A mutation is a change in our DNA sequence that happens as a result of errors in DNA…

Q: 1. Version of the Central Dogma below, being your transcription and synthesis. sure to include the…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Q. Deletion of a single AT base pair from codon number 4 can cause a frameshift mutation in a…

A: The DNA is transcribed into to an RNA by the process of transcription. Following the transcription…

Q: Recognize the impact of DNA mutations.   Summarize the process of genetic translation.

A: The mutation is the change in the sequence of the coding genes. This can happen during DNA…