a ob 00 Ω 0 O 0 α о 0 Find the percentage of viable cell and concentration of viable cell from 50ML of sample D O
Q: Please reference the carbanion in the first picture to answer the question
A: Step 1: Step 2: Step 3: Step 4:
Q: Biochemistry Question Eight - During fasting, explain what happens for carbohydrate metabolism…
A: During fasting, the body prioritizes maintaining blood glucose levels by shifting from energy…
Q: Q1
A: The upper DNA strand in the above figure is the (A) coding strand and the lower DNA strand is the…
Q: Using this information solve for enzyme activity over time 1 unit - 1 umole per minute.Total…
A: To calculate the viral protease enzyme activity in units based on the standard curve for a reaction…
Q: Please explain question 11 properly. How did you get the answer and why? What formula/law would I…
A: To convert the concentration of cortisol from milligrams per deciliter (mg/dL) to parts per million…
Q: Uniport Symport Antiport Na+ K+ ATP ATP ADP+Pi ADP+Pi pyruvate H+ HCO3 Ca2+ CI Na+ glucose Na+
A: Types of Transport Mechanisms in Facilitated Diffusion Facilitated diffusion is a crucial process…
Q: Calculate the value of K for a reaction that has ΔG° = 37.6 kJ mol-1 at 37.0 °C. (R = 8.3145 J…
A: First, we need to convert the given ΔG° value from kJ mol^-1 to J mol^-1 because the gas constant R…
Q: How does a scintillation counter measure radioactive decay per minute?
A: A scintillation counter is a device used for detecting and measuring ionizing radiation. It works on…
Q: Consider the following reaction and its equilibrium constant: 12(g) 21(g) Kp = 0.209 atm A reaction…
A: Detailed explanation: Let's analyze the given reaction and its equilibrium constant: Since Qp=3.52…
Q: Amino acids in solution have standard pka's of side chains that vary slightly depending on the book…
A: Here's the answer to your questions, broken down point by point for clarity:
Q: What is the sequence of the DNA template strand from which each of the following mRNA strands were…
A: To find the DNA template strand for each mRNA strand, recall that mRNA is produced from the DNA…
Q: Benzene is a carbohydrate ubiquitous to organic chemistry. Its structure was proposed near the end…
A: To find the molecular formula of benzene, we must first compute the empirical formula using the %…
Q: Question 2 8 words Draw the line-angle structure of a diol with the following criteria. a) It must…
A: Structure of 2-Methylpropane-1,2-diol Carbon Backbone: The main chain is propane, which has three…
Q: 2-butanol can be formed as the only product of the Markovnikov addition of H2O to two different…
A: Detailed Solutions:
Q: 1. (7 points) The enzyme fumarase catalyzes the interconversion of fumarate and malate. Show the…
A: Answer well explained above
Q: mechanism of the reaction please ( please step by step answer please)
A: Example: Mechanism of an SN2 Reaction As an example, let's consider the mechanism of a bimolecular…
Q: Give the IUPAC name for each structure. Part 1 of 3 CH3(CH2)2CO2CH2CH3 Part 2 of 3 Part 3 of 3…
A: Step 1: Rule for writing IUPAC name for Ester(i) First component of an ester name, the alkyl is…
Q: For the gas - phase equilibrium A(g) + 2 B(g) = C(g) the initial partial pressures of A, B, and C…
A: Given initial pressures are all 0.300 atm.Drawing ICE table A + 2B…
Q: Why isn't the side chain of these amino acids, Asparagine, Glutamine, and Trytophan ionizable?
A: Detailed explanation:The side chains of asparagine, glutamine, and tryptophan are not ionizable…
Q: Please explain question thoroughly.
A: Shown below are the Lewis structures. The blue arrows show the direction of polar bonds, pointing…
Q: Could you complete the following chart and explain thoroughly? How would I conjugate from acid to…
A: Approach to solving the question: Identify the species (acid or base).Determine whether you're…
Q: Draw the products of the following reactions: h & i Explain your answer thoroughly..
A: Step 1:K2Cr2O7 is a strong oxidizing agent, it can reduce aldehyde to carboxylic acid. Step…
Q: 4 Which of the following graphs, A or B, illustrates the typical behavior of a solid dissolving in…
A: The typical behavior of the solubility of solid in water is increasing solubility as the temperature…
Q: Can you use arrows to show the electron pushing? I am confused on the dashed lines shown in the…
A:
Q: None
A: A) Convert 58.76 Ms to ks:58.76 Ms = 58760 ksB) Convert 4.313 in/mi to cm/km:4.313 in/mi = 6.802…
Q: help me with part b part i and iii please . for iii. the hint is that A is constant so H and S…
A: 【i】The answer from part (a) (which would be your ΔH and ΔS values) are incorporated directly into…
Q: : D When (CH3)2CHCH2CH2CH2COOH is treated with Na2CO3, one of the products is NaHCO 3. Draw the…
A: structure: Draw the hexane chain:C-C-C-C-C-CAdd the carboxylic acid group:C-C-C-C-C-C(=O)OHAdd the…
Q: please help with this
A: Option 1 (AUCAUUCUAUUGUCCUCCACC) brings change in which UGA (encoding Cysteine) becomes UCA…
Q: Determine the number of biological forms that can exist for an aldopentose. 8 16 4 2
A: Step 1:Step 2: Step 3: Step 4:
Q: Consider each dipeptide. Part: 0 / 4 Part 1 of 4 HO || H H H3N C-C-N-C-COO Identify the amino…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Certainly, let's…
Q: Draw the structure of the a-keto acid formed by removal of the amino group during the catabolism of…
A: So, the structure of the α-keto acid after deamination of cysteine is 3-sulfanylpyruvate:…
Q: Suppose the EC50 value--the drug concentration necessary for half of a maximal effect to occur--is…
A: The EC50 is the concentration of a drug that gives half-maximal response. It is used as a measure of…
Q: 1. Draw the structures of the following: (a) trans-1,3-Dimethylcyclobutane (d)…
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: None
A: In units and measurement μ signifies micro and its value is 10−6 of the base unit.i.e.1 μg=10−6 g We…
Q: Do question 1)
A: Ethanolamine (a):Functional Groups:Hydroxyl group (-OH)Amino group (-NH2)Chiral Carbon: None (All…
Q: Why are neutral antagonists best to use for receptor classification?
A: In biochemistry, an antagonist is a substance that interferes with or inhibits the physiological…
Q: help 9
A:
Q: 4. Lipid peroxidation can lead to a bewildering number of different products. This is illustrated by…
A: Step 1: answer of questions based on the paper "Lipid Peroxidation and Free Radical Reactions of…
Q: In a phase I oxidation reaction where the addition of an oxygen to a drug generates a functional…
A: In a phase I oxidation reaction, a drug molecule undergoes a chemical transformation that often…
Q: Help please
A: Step 1:To find the pH of a lysine solution where the alpha carboxyl group is 2/3 dissociated, we can…
Q: Predict the major product after all reactions occur.( Please step by step answer and don't use hand…
A: all reaction with proper format given below
Q: O Macmillan Learning One way of expressing the rate at which an enzyme can catalyze a reaction is to…
A: To calculate the number of urea molecules that one molecule of urease can act on in 25.3 minutes, we…
Q: None
A: The mass of B formed after 2.25 hours can be calculated using the value of k and the concentration…
Q: Question 4: Complete the observation table Compound Molar mass (g/mol) p-nitrobenzaldehyde 151…
A: If we consider p-nitrobenzaldehyde as an equivalent,.Triphenylphosphine (PPh₃):Given mmol of…
Q: Note: Whenever possible type your answers. If you upload any images, e your full name in order to…
A: 1:Name: 4-bromo-3-ethyl-2-pentanol 2:Secondary alcoholQuestion 2: 1: 2:Alcohols are classified as…
Q: Derive the amino acid sequence that is coded by this mRNA sequence. Use three-letter amino acid…
A: mRNA sequence:5' GGA UGG AAU UCC AAA AUC 3' The corresponding codons are:GGAUGGAAUUCCAAAAUCNow,…
Q: Please explain question 2 thoroughly. How would I get an answer for B and C?
A: Step 1: Step 2: Step 3: Step 4:
Q: None
A: Electron flows from negative to positive. Here, methanide (CH3-ve) takes the proton (H+) and the O-H…
Q: None
A: Step 1: Step 2: Step 3:Step 4:
Q: Skeletal muscle cells (myocytes) store energy by synthesizing ____________ when blood sugar is…
A: The correct answer is:glycogen; highWhen blood sugar (glucose) levels are high, skeletal muscle…
Step by step
Solved in 2 steps
- Abiologist prepares a slide ofstained cells undergoing mitotic prometaphasefor examination undera light microscope. He sees several very dark stained rod – shaped structures in the cells. These “colored bodies” are most likely?M Inbox (92)-hoskins X OFOB Bellringers 10/2 X C Clever | Portal A encase.te21.com/Assessment/View/37f019e7-1666-4a8c-aca4-d9 CHCASE FOB Macromolecules/Cells Test 10/28-29/2020 Section 1 12 of 23 A student is examining a stained animal cheek cell using a light microscope. Which cell structure is visible to the student at 100x magnification? cell wall mitochondrion O nucleus O ribosome Copyright 2020 Certica Solutions, Inc. HR51023/15ed1933-4dea-The cell wall is ___________ . interior to the cell membrane exterior to the cell membrane a part of the cell membrane interior or exterior depending on the particular cell
- 12In the box below, post a histologic appearance of a cell who had undergone atrophy. Label the specimen (what body part), also identify the cells present.11:03 1 ull 5G 4 Today Edit 12:19 AM Which of these is not a cell membrane protein? O cell-identity marker O channel O peroxisome O cell adhesion molecule
- What are the strengths and weaknesses of the cell model?Unit 5 Test Part 2 E Unit 5 Test Part 2 m/forms/d/e/1FAlpQLSel6CRM61QcDBCsgyf50p_qypzPCVMyrZ9wsAWoSdwbXipm_w/viewscore?viewscore=A Which statement does not describe cell cycle checkpoints? Normal checkpoints assess damage to DNA. B Faulty checkpoints may lead to abnormal cell growth. C Cell checkpoints can fail in mitosis and meiosis. D Defective checkpoints result in the death of the cell. A 1 Human bone, muscle, and nerve cells all contain the same number of chromosomes with th same complement of genes. What enables these cells to perform specialized activities?I need a solution within 15 minutes
- Estimate the time spent in each phase (duration) assuming that the cell cycle for a skin cell is 24hrs (1440min). Show your work.od 1 Meet- zpn-oxtp-bxu Unit 2 test - cells, organelles, mer X G In order to deteminie how cells rx A testing.illuminateed.com/assessment/5f765e7b4c2b2eb5078b7842/5f765e7b4c2b2eb5078b7843/1?rldbqn=1 ail YouTube Maps O News (1) Facebook Launch Meeting - Z... TikTok sues U.S. go... i! Spanish Present Pro... embrane, transport fall 2020 D. Water moves into and out of the cell at the same rate since the cell is isotonic to its environment. 7. In carrying out normal activities, cells use oxygen and produce carbon dioxide. The concentration of oxygen is higher in the blood than inside the cell, so oxygen moves into the cell. Similarly, carbon dioxide moves out of the cell into the blood because the concentration of carbon dioxide inside the cell is greater than the concentration outside the cell. How do the small molecules of oxygen and carbon dioxide move through the cell membrane?12/ cell determination is the expression of the cell's specialized role true or false
