(b) Shown below is a website from a company that sells oligonucleotides as primers. They provide a discussion of how they calculate Tm for the oligos that you might purchase using a table of AH and AS values that you add up for your sequence. Describe how an equation like Eq. 1 can be derived from AG(Tm) = AH- TAS and indicate: (i) how your answer(s) to part (a) are incorporated into Eq. 1. (ii) why is 1000AH used but not 1000AS ? (iii) if there is any error in the formula shown sigmaaldrich.com Melting Temperature ☐ etermining the melting temperature, Tm, of an oligo is essential for many applications such as PCR, capture assays, mutagenesis, hybridization, and sequencing. The exact Tm of your DNA can be deter- mined only by empirical means.' However, the three theoretical methods described here can approximate the Tm. Selecting the appropriate equation depends on your application. What is Tm? The Tm, or melting temperature, of an oligo is the temperature at which 50% of the oligonucleotide and its perfect complement are in duplex. Typically, annealing or hybridizations are performed at 5-10 °C below the Tm of a duplex. Failing to calculate the correct Tm for an oligo could result in inappropriate duplex formation. Primer mismatch, false priming, and background signal problems could result if annealings and hybridizations are performed at temperatures significantly below the oligo Tm. Using temperatures well above the Tm of an oligo could result in reduced priming, or no priming or hybridization. The main factors affecting Tm are salt concentration, DNA concentration, the presence of denaturants (formamide or DMSO), DNA sequence, and length. Nearest Neighbor Method At Sigma-Genosys, we use the nearest neighbor method to deter- mine the Tm of oligonucleotides. This equation is considered to be one of the more accurate derivations of Tm. The nearest-neighbor method takes into account the actual sequence of your oligo, whereas the other equations rely on the base composition to calculate Tm. With the nearest-neighbor method, several oligos with the same length and base composition, but differing sequences, would have a different Tm. In Table 1, each of the sequences contain 5 As, 5 Cs, 5 Gs, and 5 Ts. Notice the Tm varies with each sequence despite the base composition being the same. Table 1. Varying values of sequences with the same GC content. The nearest-neighbor method incorporates certain variables such as salt concentration and DNA concentration. Sigma-Genosys uses conditions typically found in PCR applications (50 mM monovalent salt and 0.5 μM primer). The nearest-neighbor equation for DNA and RNA-based oligos is: (1) Tm (1000AH/A+AS+ Rin (C/4)) - 273.15 + 16.6 log[Na+] AH (Kcal/mol) is the sum of the nearest-neighbor enthalpy changes for hybrids. A is a small, but important constant containing correc- tions for helix initiation. AS is the sum of the nearest-neighbor entropy changes. R is the Gas Constant (1.99 cal K-'mol), and C is the concentration of the oligo. The AH and AS values for nearest- neighbor interactions of DNA and RNA are shown in Table 2. In many cases this equation gives values that are no more than 5 °C from the empirical value. Please note that this equation includes a factor to adjust for salt concentration. Table 2. Thermodynamic parameters for nearest-neighbor melting temperature formula. DNA RNA Interaction ΔΗ AS ΔΗ AA/TT -9.1 -24.0 -6.6 AS -18.4 AT/TA -8.6 -23.9 -5.7 -15.5 TA/AT -6.0 -16.9 -8.1 -22.6 CA/GT -5.8 -12.9 -10.5 -27.8 GT/CA -6.5 -17.3 -10.2 -26.2 CT/GA -7.8 -20.8 -7.6 -19.2 GA/CT -5.6 -13.5 -13.3 -35.5 CG/GC -11.9 -27.8 -8.0 -19.4 GC/CG -11.1 -26.7 -14.2 -34.9 GG/CC -11.0 -26.6 -12.2 -29.7 Initiation 0.0 -10.8 0.0 -10.8 Sequence (5'-3') AAAAACCCCCGGGGGTTTTT Tm 69.7 MW LEN GC 6103 20 50% ACGTACGTACGTACGTACGT 57.2 6103 20 50% GATCGATCGATCGATCGATC 64.5 6103 20 50% ATATATATATCGCGCGCGCG 66.4 6103 20 50%