### mRNA Structure and Translation Process**7. mRNA Analysis from Bacteria:**A sequence of mRNA is presented as follows:```5′- GUUUCCGAGGAGGCGUAUAC AUG UCAGUGGGGGC… -3′```**a. Ribosome Binding Site:**i. **Binding Molecule:** The ribosome binding site (RBS), also known as the Shine-Dalgarno sequence in bacteria, is underlined. The specific molecule that binds to the RBS is the *small subunit of the ribosome*.ii. **Importance of Binding:** Binding to the RBS is crucial for the initiation of translation because it positions the ribosome correctly on the mRNA, allowing the start codon (AUG) to align with the ribosome's peptidyl (P) site for the initiation of protein synthesis.**b. First Amino Acid in Translation:**During translation, the amino acid that will be attached to the first tRNA binding in the **A site** of the ribosome is determined by the start codon (AUG). According to the genetic code chart, this codon codes for *Methionine (MET)*, which is also the start of most protein synthesis processes.**c. Location of Amino Acid Chain Post-Peptide Bond Formation:**Immediately following peptide bond formation, the amino acid chain will be located in the:- ( ) A site of the ribosome- (**X**) P site of the ribosome- ( ) E site of the ribosome**d. Termination of Translation:**The termination of translation involves several steps:1. **Stop Codon Recognition:** When the ribosome encounters a stop codon (UAG, UAA, UGA) on the mRNA sequence in the A site, translation ceases as there are no corresponding tRNA molecules.2. **Release Factors:** These proteins bind to the stop codon, prompting the release of the polypeptide chain from the tRNA in the P site.3. **Dissociation:** The entire translation complex, including the mRNA, tRNA, and ribosomal subunits, dissociates, concluding protein synthesis.**Genetic Code Chart Explanation:**The accompanying diagram is a standard genetic code chart used to translate nucleotide triplets (codons) into amino acids. Each intersection of the

Name: ### mRNA Structure and Translation Process**7. mRNA Analysis from Bac
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: ### mRNA Structure and Translation Process**7. mRNA Analysis from Bacteria:**A sequence of mRNA is presented as follows:```5′- GUUUCCGAGGAGGCGUAUAC AUG UCAGUGGGGGC… -3′```**a. Ribosome Binding Site:**i. **Binding Molecule:** The ribosome binding