Answered: 12. Which of the following molecules…

12. Which of the following molecules can absorb light? a. Pigments b. Chlorophyll c. Rhodopsin d. Carotenoids e. All of the above

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter5: Capturing And Releasing Energy

Section: Chapter Questions

Problem 3SQ: Which of the following statements is incorrect? a. Pigments absorb light of certain wavelengths...

See similar textbooks

Related questions

Q: Draw a spinal section.• Shade in the parts containing grey matter• Leave the parts containing white…

A: A. Dorsal direction (shown by red arrow)B. Ventral direction (shown by red arrow)

Q: Hello, Can you please help me with an overview of Microbemia. A description of the causative agent,…

A: Key references: Morris, A. C., & DeVoe, C. (2016). Bacteremia and sepsis: Understanding the…

Q: a)What region of the DNA do general transcription factors and RNA polymerase bind to? b)Where, in a…

A: General transcription factors and RNA polymerase bind to a specific region of the DNA known as the…

Q: So, starting with a culture of 1000 E. coli, how many would I obtain after 16h of ideal growth…

A: To determine how many E. coli bacteria would be present after 16 hours under ideal growth…

Q: What are your personal thoughts after reviewing these three aricles below? A Comprehensive…

A: Refer to the solution

Q: QUESTION 2 Which of the following is induced by pyrogens? O Fever A body temperature above 38…

A: Pyrogens are substances, typically produced by bacteria, that can cause a rise in body temperature.…

Q: Distinguish between descriptive and analytic approaches to occupational epidemiology.

A: Occupational epidemiology is a branch of epidemiology that focuses on the study of workers and the…

Q: Find out about the organisations and the movements aimed at the conservation of our natural…

A: Approach to solving the question: through finding about Environmental Conservation Organizations and…

Q: 5' CCTAGCTTTCCGATAAAGCTATTCAAGT 3' The Alu1 enzyme cuts at this sequence: 5' AGCT 3' sequence. How…

A: To determine how many DNA fragments result from cutting the given DNA sequence with the AluI enzyme,…

Q: a) Suppose a married couple comes to you for counseling. Both of them have a genetic disorder, but…

A: For the first couple, if both parents have the genetic disorder, it suggests that the disorder is…

Q: 56% 1. In the lab report, where are tables and figures In the Results 2. What are the three types of…

A: 3 a x axis= monthsy axis= temperature (F)line represent 2 different years (orange 2015, blue 1915)…

Q: Why is it important to know how much is biodegradableand non-biodegradable?

A: Biodegradable materials are those that can be broken down naturally by microorganisms into simpler…

Q: 1) Describe how you would test the hypothesis that lobe eyes are a dominant lethal gene. Run the…

A: L = dominant allele for lobe eyes (lethal in homozygous form)l = recessive allele for normal…

Q: Put the steps of eutrophication in order. Algae sink to the bottom. Nutrients enter a lake; algae…

A: Eutrophication is a process driven by the addition of nutrients, primarily nitrogen and phosphorus,…

Q: Use visible colours Concept Map Assignment Create a concept map using MindMup software. Start with…

A: Solution:When it comes to plant reproduction, there are many aspects to be thankful for this holiday…

Q: What were the three fragment lengths you got in your sample?

A: Based on the marker given in the figure, the size of the:1st band (top most): 6000 bp.2nd band…

Q: Not use ai please

A: Receptor Binding (Correct Answer): Hormone communication via receptor binding is a precise and…

Q: What are the indications for incentive spirometry?

A: Incentive spirometry is a breathing exercise technique that is designed to encourage patients to…

Q: 5. The image below shows the organization of a type IV protein that resides on the ER membrane. The…

A: Based on the given diagram and instructions, here is a detailed explanation and breakdown of how to…

Q: The following is the partial sequence of a bacterial gene ORF: 5’…

A: EcoRI is significantly more efficient for cloning compared to SmaI due to its ability to produce…

Q: 2b. Is ATP required for this reaction to proceed? Explain.

A: The energy graph and enzyme-catalyzed process are depicted to determine if ATP is required for the…

Q: Other than oil and alcohol, are there other liquids you could compare to water (that are liquid at…

A: For Question 1: The examples I have given is solution/elements that are in liquid form in room…

Q: Question 4 Describe Mechanism and give full answer of this question and don't use chatgpt otherwise…

A: Penicillin resistance occurs when bacteria develop the ability to survive and multiply in the…

Q: Literature review investigating the positive impact of water conservation on sandals Resort open

A: Water conservation refers to the reduction in water usage and the protection of water from…

Q: Answer in step by step with explanation. Don't use Ai and chatgpt.

A: Step 1: Set Up the Genotypes Fly #1: bbEe.Fly #2: Bbee. Step 2: Identify Possible Gametes for Each…

Q: A signal peptidase cleaves off the signal sequence upon import of the protein into the mitochondrial…

A: Here's an explanation of why the other options are incorrect: A. Outer membraneThe outer membrane's…

Q: HOW TO FIND THE ALELLE FREQUENCY WHEN THE OBSERVED GENOTYPE IS: AA:51, AB:232, BB:1197

A: Approach to solving the question: Step-by-step explanation for calculating allele frequencies based…

Q: Match these: A.) Chargaff B.) Mendel C.) Griffith D.) Beadle E.) T.H. Morgan F.) Meselsen G.)…

A: Sure! Here is a more detailed explanation for each answer:1. _I) Franklin_Rosalind Franklin was a…

Q: Testing yourself is a helpful way to study, according to Dr. Anne Cleary, an expert in science of…

A: Question: Define the term 'allele'.Answer: An allele is one of two or more versions of a gene that…

Q: 1. Using the schematic on the right, which section (A or B) will exhibit the highest osmolarity…

A: In the kidney, the renal medulla (section B) will exhibit the highest osmolarity. This is because…

Q: How does complement promote the immune response? Describe three ways

A: Approach to Solving the Question To answer how the complement system promotes the immune response,…

Q: Question 2. same chromosome. For all parts of this question, the E and G genes are 8 map units apart…

A: Approach to solving the question:Given information:- E and G genes are 8 map units apart on the same…

Q: Which of the following molecules will not dissolve in water?a. Non-polar Lipophilic moleculesb.…

A: First, we need to understand the nature of the molecules listed in the question. Water is a polar…

Q: Hello, Can you please help me to decribe "Poliomyelitis" please? The pathogen associated with the…

A: Poliomyelitis (Polio)Poliomyelitis, commonly called polio, is a highly infectious viral disease…

Q: a) What has happened in Bernalillo County to the number of cases of COVID-19 since 01.01.21?…

A: As a subject matter expert, I don't have real-time data. However, you can find the most recent and…

Q: The lower teeth are anchored in the:a. nasal bonesb. zygomatic bonesc. mandibled. maxilla

A: The lower teeth are anchored in the mandible.

Q: b. The coding sequence begins with AUG. What does AUG signify in terms of translation? The Standard…

A: Question b. What does AUG signify in terms of translation?Answer: The AUG codon is the start codon…

Q: Imagine that you are part of a research team that specializes in diagnosing disorders associated…

A: The diagnostic analysis of a two-day-old newborn male patient with systemic symptoms highlights the…

Q: * 17. When a Chinese hamster with white spots is crossed with another hamster that has no spots,…

A: Detailed Further ExplanationThe scenario described suggests a classic case of Mendelian inheritance…

Q: Partial base sequence of an RNA molecule is known as: 5'---AGCU---3'. Write structural formula of…

A: Or for clearance Hopefully this is helpful to you.

Q: QUESTION 17 Which of the following immune cells kills infected cells by releasing the lethal protein…

A: The immune system is a complex network of cells, tissues, and organs that work together to defend…

Q: There has been considerable concern about finding good ways to treat infections involving biofilms,…

A: First, let's describe a biofilm. A biofilm is a community of microorganisms living together in a…

Q: Which of the following is true concerning the role of Calcium in the contraction ofmuscle-cells?A.…

A: Calcium plays a crucial role in the process of muscle contraction. It is the key ion that initiates…

Q: a) In a scientific research article, what is the purpose of the introduction? b) Scientific papers…

A: Answer well explained above

Q: You suspect a protein to be secreted out of a cell. What experiment would you perform to follow the…

A: Why the other options are incorrect: B. Signal Sequence DeletionDeleting the signal sequence would…

Q: Question 4 (Mandatory) (2 points) Match the following graphs with their likely p-values. 4.5 3.5 I…

A: Step 1: Analyze the first graph.To answer this question, we need to first understand the…

Q: Describe the indicators used to measure the nutritional status of children in the Caribbean.

A: The nutritional status of children is a critical indicator of a community's overall health. In the…

Q: Answer in step by step with explanation. Don't use Ai. Answer in all options. Answer in 100% human.

A: Altruistic behavior is when a person assists others without any expectation of getting something…

Q: a) What is a silencer and how does it impact transcription? b) enhancers are proteins DNA regions…

A: A silencer is a DNA sequence capable of binding transcription regulation factors, called repressors.…

Q: Can any of the structures labelled 4,5,9, and 11 play a role in signalling?

A: Let's analyze the structures labeled 4, 5, 9, and 11 in the image to determine their potential roles…

Question

12. Which of the following molecules can absorb light?
a. Pigments
b. Chlorophyll
c. Rhodopsin
d. Carotenoids
e. All of the above

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Which color(s) of light does chlorophyll a reflect? a. red and blue b. green c. red d. blue
Where is chlorophyll located in the chloroplast? (a) thylakoid membranes (b) stroma (c) matrix (d) thylakoid lumen (e) between the inner and outer membranes
Which of the following is a correct step in the light-dependent reactions of the Z system? a. Light is absorbed at P700, and electrons flow through a pathway to NADP+, the final acceptor of the linear pathway. b. Electrons flow from photosystem II to water. c. NADP+ is oxidized to NADPH as it accepts electrons. d. Water is degraded to activate P680. e. Electrons pass through a thylakoid membrane to create energy to pump H+ through the cytochrome complex.
Which statement about thylakoids in eukaryotes is not correct? a. Thylakoids are assembled into stacks. b. Thylakoids exist as a maze of folded membranes. c. The space surrounding thylakoids is called stroma. d. Thylakoids contain chlorophyll.
An organism characterized as a photoautotroph obtains energy from _____ and carbon from _______. (a) light; organic molecules (b) light; CO2 (c) organic molecules; organic molecules (d) organic molecules; CO2 (e) O2; CO2
Which of the following is the major site of photosynthesis?______ apical meristem ground tissue xylem cells phloem cells
In photolysis some of the energy captured by chlorophyll is used to split (a) CO2 (b) ATP (c) NADPH (d) H2O (e) both b and c
Where in plant cells does the Calvin cycle take place? a. thylakoid membrane b. thylakoid space c. stroma d. granum
Figure 8.18 Which of the following statements is true? In photosynthesis, oxygen, carbon dioxide, ATP, and NADPH are reactants. G3P and water are products. In photosynthesis, chlorophyll, water, and carbon dioxide are reactants. G3P and oxygen are products. In photosynthesis, water, carbon dioxide, ATP, and NADPH are reactants. RuBP and oxygen are products. In photosynthesis, water and carbon dioxide are reactants. G3P and oxygen are products.
You bite into a spinach leaf. Which one of the following is true? a. You are getting 50% of the protein in the leaf in the form ofribulose 1,5-bisphosphate carboxylase. b. The major pigment you are ingesting is a carotenoid. c. The water in the leaf is a product of the light-independentreactions. d. Any energy from the leaf you can use directly is in the form ofATP. e. The spinach most likely was grown in an area with a low CO2 concentration.
Plants containing only chlorophyll b are exposed to radiation with the following wavelengths: 10nm (x- rays), 450nm (blue light), 670nm (red light), and 800nm (infrared light). Which plants harness the most energy for photosynthesis? X-ray irradiated plants Blue light irradiated plants Red light irradiated plants Infrared irradiated plants
What accumulates inside the thylakoid compartment of chloroplasts during the light-dependent reactions? a. sugars b. hydrogen ions c. O2 d. CO2