1. Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and Bcll. a) Shown below is a BamHl recognition site, which cleaves after the first G. Does cleavage by BamHI result in a 5' or 3' overhang? 5... GGATCC...3 3...CCTAGG...5 b) Shown below is a Bcll recognition site, which cleaves cleaves after the first T. Does cleavage by Bcll result in a 5' or 3' overhang? 5... TGATCA...3" 3... ACTAGT...5 You are given the DNA shown below. 5' ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3' 3' TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5' c) If the above DNA was cut with BamHI, how many DNA fragments would you expect? Write out the sequence of these double-stranded fragments.

1. Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and Bcll. a) Shown below is a BamHl recognition site, which cleaves after the first G. Does cleavage by BamHI result in a 5' or 3' overhang? 5... GGATCC...3 3...CCTAGG...5 b) Shown below is a Bcll recognition site, which cleaves cleaves after the first T. Does cleavage by Bcll result in a 5' or 3' overhang? 5... TGATCA...3" 3... ACTAGT...5 You are given the DNA shown below. 5' ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3' 3' TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5' c) If the above DNA was cut with BamHI, how many DNA fragments would you expect? Write out the sequence of these double-stranded fragments.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Scientists who study amino acid biosynthesis pathwayswant to isolate auxotrophic bacteria. A technique calledpenicillin enrichment makes this task easier. This procedure starts by exposing a liquid culture of wild-type (prototrophic) bacteria growing in rich (complete)medium to a chemical mutagen. After this treatment,the cells are centrifuged to remove the liquid and themutagen. The pellet of cells at the bottom of the centrifuge tube is now resuspended in medium that lacksone amino acid (in this example, cysteine) but contains penicillin. Subsequently, the bacteria are pouredonto a filter that concentrates them and allows themto be washed free of the penicillin. The living bacteriaretained on the filter are highly enriched for cysteineauxotrophs.a. Given what you know about the action of pencillin,explain why this enrichment occurs.b. Penicillin enrichment is not a selection, becausethe drug does not kill 100% of the prototrophs.The cells on the filter thus need to be screenedfor…
Describe the cloning strategies that are mediated by homopolymers tailing, linkers and adaptors. How can adaptors be employed for the creation of a novel restriction enzyme site for the introduction of the insert DNA?
2. You are planning to clone a gene into the PBR322 plasmid vector. The gene has Bgl II restriction enzyme sites on both the 5' and 3' ends. Restriction enzyme Recognition site 5'... CTGCAG...3' 3... GACGTC... 5 5... GAATTC...3' 3:... CTTAAG. ECORI Hindil Pst I BamH Eco RI 5' Tetracycline Resistance Hind III 5...AAGCTT...3' PBR322 (4.36 kb) Xmalll 3...TTCGAA ... 5' 5... GGATCC...3' 3... CCTAGG...5' 5...CCCGGG...3° 3...GGGCCC ... 5 5... A'G ATCT...3 3... TCTAGA... 51 Bam HI Origin Replication Xma l BglI E. coli PBR322 plasmid showing restriction sites and resistance genes. Pvull With which restriction enzyme would you cut the PBR322 plasmid vector? Give a reason for your answer. You assemble a ligation reaction to join the gene to the plasmid DNA. What types of product would you expect to obtain from the ligation reaction? Please consider the selection marker genes, Ampicillin resistance gene and Tetracycline resistance gene. What would the antibiotic resistance phenotype be of a…
6. Mutation analysis of GCK gene in patients with diabetes revealed a c.114 TàA (shown in bold and underlined) substitution in heterozygote state. In order to check the mutation in healthy individuals, restriction enzyme analysis will be used. a) (5p) Which enzyme can we use to differentiate wild type and mutant sequence? Please indicate which allele (wild type or mutant allele) will be cut with the restriction enzyme. Use table 1 shown below. b) (10p) Draw the expected agarose gel result of a homozygous wild type, homozygous mutant and heterozygote individual after restriction enzyme analysis. ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGC ATGGCAGCTCTAATGACAGGATGGTCACCCCTG CTGAGGCCACTCCTGGTCACCATGACAACCACA GGCCCTCTCAGTATCACAGTAAGCCCTGGCAGG AGAATCCCCCACTCCACACCTGGCTGGAGCACG AAATGCCGAGCGGCGCCTGAGCCCCAGGGAAGC AGGCTAGGATGTGA Figure 1. GCK gene sequence. Length of the fragment is 213bp. Table1. The restriction enzymes and their recognition sequences. Restriction enzyme|Recognition sequence GG/CGCC Nar…
1. A DNA sequence 10 kb long contains one site at which it may be cut by the restriction enzyme Pstl. The same 10 kb long sequence also contains one site that can be cut by restriction enzyme Bg/II. Three separate fractions of this DNA were treated separately, as follows: 1) digestion by Pstl; 2) digestion by Bg/II; 3) digestion by both enzymes. The three treated fractions were then subjected to gel electrophoresis. The following table shows the lengths of the restriction fragments associated with each treated fraction. From the result, draw a restriction map that shows the Pst and the Bg/II cutting sites in the 10 kb DNA. Enzyme in mixture Pstl BgIII Pstl and BgIII Fragment Lengths (kb) 6.4 and 3.6 8.8 and 1.2 5.2, 3.6 and 1.2
Genome annotation refers to ... 1.) lining up overlapping regions in short shotgun sequencing reads to assemble larger contiguous DNA sequences (contigs/scaffolds). 2.) using long-read sequencing platforms (such as PacBio or Oxford Nanopore) to gather information about the epigenetic status of each region of a sequenced genome. 3.) the process of predicting which parts of a genome sequence code for functional products (such as protein-coding genes), what those products do, and assigning them names. 4.) sequencing messengeRNA measure the relative expression levels of genes in one or more tissue samples.
2. In order to make a recombinant plasmid for transformation, ЕcoRI you digested a bacterial plasmid with restriction enzyme 5'... GAATTC...3' EcoRI. You want to insert a gene of interest that codes for antibiotic resistance. You decide to try both XXRI and ZZRI 3... CTTAAG...5' restrictions enzymes for the antibiotic resistance gene. For XXRI, would you expect the gene insertion process to work? Why or why not? If you grow your transformed bacteria (assuming all other parts of а. XXRI 5... GAATTC...3 3..... СТТАA G...5 transformation work), what would you expect to see on an LB/antibiotic plate? b. For ZZRI, would you expect the gene insertion process to work? Why or why not? If you grow your ZZRI transformed bacteria (assuming all other parts of transformation work), what would you expect to see on an LB/antibiotic plate? 5... A A ATTL...3' 3... TTTA A A... 5
. The DNA polymerases are positioned over the following DNA segment (which is part of a much larger molecule) and moving from right to left. If we assume that anOkazaki fragment is made from this segment, what will be the fragment’s sequence? Label its 5′ and 3′ ends. 5′.…CCTTAAGACTAACTACTTACTGGGATC….3′ 3′.…GGAATTCTGATTGATGAATGACCCTAG….5′
To quantify the transcription product of a specific gene in E. coli, you may use (select all correct answers) O a. Northern blotting O b. Topoisomerase I O C. Primer extension O d. Foot-printing
a.) Draw a eukaryotic gene with four exons (include the location of the promoter, enhancer, start and stop codon, poly-A signal sequence, 5' UTR, and 3'UTR.). b.) Draw the primary transcript. c.) Draw all of the possible fully mature mRNAs that can be produced from this locus.
18. Shown below are the results of a series of coinfections of E. coli B using T4 rlI- strains similar to those employed by Benzer in his deletion mapping experiment. Each strain contains a different deletion mutation. The ability to produce wild-type progeny phage is indicated by (+), (0) indicates no wild-type progeny. A D A B D E Which order of deletions is most consistent with this data? a. CDBEA b. DCEAB C. ABECD d. CDEAB e. EDCBA
Describe three (3) ways in which the primary transcript is modified as it is converted to mRNA.