1 Sardinella tawilis voucher TaSt3 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial SCAGGGATAGTAGGGACTGCCCTAAGTCTCCTAATTCGGGCGGAGCTAAGCCAGCCCGGGGCGCTCCTTGGGGACGACCAGATTTACAACGTCATCGTCACGGCACATGCCTTCGTAATG STGATGCCAATTCTAATTGGGGGTTTTGGGAACTGGCTCGTCCCTCTAATGATCGGGGCGCCAGACATGGCATTCCCGCGAATAAACAACATGAGCTTCTGGCTCCTTCCCCCTTCCTTCCT CTCTTCGGGCGTAGAGGCCGGGGCAGGGACGGGTTGAACAGTATACCCGCCCTTGGCAGGCAATCTTGCCCACGCCGGGGCCTCTGTCGACCTTACCATCTTCTCACTCCACCTAGCAG TTCTTGGGGCGATTAACTTTATCACCACAATTATTAATATGAAACCCCCTGCAATTTCACAGTACCAAACGCCTCTCTTCGTTTGAGCTGTTCTCGTAACCGCTGTGCTTCTCCTTCTCTCCCT CTGCCGGGATCACTATGCTATTAACAGATCGAAACTTAAATACAACTTTCTTCGACCCTGCAGGAGGAGGAGACCCAATTCTATACCAACACCT ed section refers to the ion number er number number cation number of the sequence?

Q: Contrast the resultant orientation of the macrodipoles of cytochrome b562 consisting of 4…

A: Helical structures like alpha-helix secondary structures in proteins have macrodipoles. Every…

Q: If a protein with the sequence AGFEWPRQVDMARINE is treated with chymotrypsin, what will the products…

A: Proteins are made up of amino acids. Two amino acids are joined by a peptide bond in a protein.…

Q: 63. Given the single stranded DNA shown below (written 5' to 3') and the genetic code, which…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: The determination of the mass of a protein by mass spectrometry often does not allow its unique…

A: Trypsin : It is an enzyme that helps us digestion protein. In the small intestine, trypsin breaks…

Q: The S3’ pocket on PfSUB1 (attached) contains the side chains of Lys465 and Tyr427. Researchers…

A: According to Michaelis-Menten Kinetics, when the rate or velocity of an enzyme catalyzed reaction…

Q: the mRNA and DNA used to synthesize the polypeptide sequence shown and the nucleotides of the tRNA…

A: DNA has two strands. One is called template strand and other is called coding strand. These two…

Q: A different Fab fragment binds to lysozyme with a dissociation constant of Kd=10-6 M. A 1 nM (10-9…

A: Consider the following reaction: where P is the protein, L is the ligand and k1 and k2 are rate…

Q: I was wondering if it is possible to provide an explanation on the structure of the PDB code 2V1X,…

A: Each PDB code represents a unique identifier for a particular protein structure. The PDB code is…

Q: Translate the following mRNA sequence into the appropriate amino acid sequence.…

A: Messenger RNA is referred to as mRNA. It is a specific kind of RNA (ribonucleic acid) molecule that…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: The activation energy of an uncatalyzed reaction is 91 kJ/mol. The addition of a catalyst lowers the…

A: The rate of a chemical reaction is generally given by the Arrhenius equation:k = A *…

Q: A Class Il aminoacyl-tRNA synthetase installs the formyl-methionine on tRNAMet in bacteria. A…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: 50 microliters of your original sample to the Bradford reagent. What is the concentration of your…

A: Proteins are made up of amino acids that have been polymerized. As a result, amino acids are…

Q: Stapphylococcus aureus V8 protease cleaves at the C-termini of Asp and Glu. How many fragments do…

A: Protein is a sequence of amino acid which are joined by peptide bonds.

Q: 4.08 H H ↓ 1.02 ↓ | 2.54 11.02↑ E E Note: 1.67 = EXON = INTRON E 10.8 kbp 3.94 3.66 E = EcoRI site H…

A: Endonuclease HindIII is a type II restriction enzyme that recognizes and cleaves the palindromic…

Q: Describing Functions: Building Vocabulary Skills In your own words, define each of the following in…

A: Translation process takes place in the cytoplasm of the cell. It involves tRNA, mRNA, large and…

Q: Here is a putative peptide sequence (position number on top of residues): 1 2 3 4 5 6 7 8 9 10 11…

A: Hi! Thanks for your question. As you have posted multiple sub-parts, we are answering only the first…

Q: Cytosine deaminationoccurs ~100 cytosinesper genome per day in a human genome. Eukaryotic cells…

A: Deamination is the removal of the aminogroup from a base.  For example; the deamination of the…

Q: MATCH a structure from the list helow to each ofthe following terms. Place the letter of the…

A: Amino acids are the biomolecules that are used to form proteins by joining the amino acids with the…

Q: Name and explain the three possible consequences of having a mutation somewhere in the region from…

A: Mutations are the alterations in the nucleotide sequence of the genome of an organism that occurs…

Q: You are analyzing the peptide ala-ile-glu-lys-phe-val- tyr-cys. If you treat the peptide with…

A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…

Q: Match the ribosome antibiotics with their binding sites and activities Puromycin [ Choose ]…

A: Antibiotics are chemical synthesized drugs used to kill or slow the growth of microbes that can…

Q: The addition of poly(U) is important in the degradation of mRNAs encoding which of the following…

A: The addition of poly(U) refers to the process of adding a string of uridine (U) nucleotides to the…

Q: Reverse translate the sequence of insulin pasted…

A: To reverse translate the given sequence of insulin and optimize the codons for Homo sapiens and…

Q: You gathered your data from Lab 4, and found the following values: Total Activity of lysozyme in…

A: Total Activity of lysozyme in HEW: 14 units  Total amount of protein in HEW: 70 mg  Total Activity…

Q: Fill the table given the info below. Please thank you. Protein at 1 mg/mL which is also 1g/L. Use…

A: To fill out the table given the provided information and the DNA sequence, we will need to calculate…

Q: Give typing answer with explanation and conclusion The following gene codes for a liver enzyme.…

A: We need to figure out which choice would cause a mistake in the DNA sequence by changing the A/T…

Q: 1. A) Explain this statement, “Most enzymes are gene-encoded proteins, but most enzymes are not only…

A: Enzymes are the catalysts, which are composed of proteins. They help in enzyme catalysis, in which…

Q: Consider the Ramachandran plot to answer both questions. Which observation most likely describes…

A: The proteins are polypeptide chains of amino acids. These amino acids are packed into protein…

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). 

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.