How many amino acids (aa) does your protein have? 1,106 aa 551 aa 1,367aa 508aa 1,210 aa   Gene Sequence (5'-to-3'): atggaccacctcggggcgtccctctggccccaggtcggctccctttgtctcctgctcgctggggccgcctgggcgcccccgcctaacctcc cggaccccaagttcgagagcaaagcggccttgctggcggcccgggggcccgaagagcttctgtgcttcaccgagcggttggaggactt ggtgtgtttctgggaggaagcggcgagcgctggggtgggcccgggcaactacagcttctcctaccagctcgaggatgagccatggaag ctgtgtcgcctgcaccaggctcccacggctcgtggtgcggtgcgcttctggtgttcgctgcctacagccgacacgtcgagcttcgtgcccct agagttgcgcgtcacagcagcctccggcgctccgcgatatcaccgtgtcatccacatcaatgaagtagtgctcctagacgcccccgtgg ggctggtggcgcggttggctgacgagagcggccacgtagtgttgcgctggctcccgccgcctgagacacccatgacgtctcacatccgc tacgaggtggacgtctcggccggcaacggcgcagggagcgtacagagggtggagatcctggagggccgcaccgagtgtgtgctgag caacctgcggggccggacgcgctacaccttcgccgtccgcgcgcgtatggctgagccgagcttcggcggcttctggagcgcctggtcg gagcctgtgtcgctgctgacgcctagcgacctggaccccctcatcctgacgctctccctcatcctcgtggtcatcctggtgctgctgaccgtg ctcgcgctgctctcccaccgccgggctctgaagcagaagatctggcctggcatcccgagcccagagagcgagtttgaaggcctcttcac cacccacaagggtaacttccagctgtggctgtaccagaatgatggctgcctgtggtggagcccctgcacccccttcacggaggacccac ctgcttccctggaagtcctctcagagcgctgctgggggacgatgcaggcagtggagccggggacagatgatgagggccccctgctgga gccagtgggcagtgagcatgcccaggatacctatctggtgctggacaaatggttgctgccccggaacccgcccagtgaggacctccca gggcctggtggcagtgtggacatagtggccatggatgaaggctcagaagcatcctcctgctcatctgctttggcctcgaagcccagccca gagggagcctctgctgccagctttgagtacactatcctggaccccagctcccagctcttgcgtccatggacactgtgccctgagctgcccc ctaccccaccccacctaaagtacctgtaccttgtggtatctgactctggcatctcaactgactacagctcaggggactcccagggagccc aagggggcttatccgatggcccctactccaacccttatgagaacagccttatcccagccgctgagcctctgccccccagctatgtggcttg ctcttag

Q: DNAT  A  C        C  G  C     T  C  C       G  C  C       G  T  C       G  A  C      A  A  T…

A: The self-replicating biomolecules that are present in the chromosomes and carry genetic information…

Q: What is the resulting polypeptide: _______________________________________________________? What…

A: Mutation in a gene sequence causes encoding of a mutated protein. This mutated protein will have…

Q: Glycosylation is a major type of protein post-translational modification. Identify the amino acid…

A: Cavalent or generally enzymatic reactions takr place after or during translation are termed as post…

Q: the peptide (written N-terminal to C-terminal) represented by Ala-Ser-Ala-Tyr the same as the…

A: Ans. Yes, the polypeptide chain of amino acid will be Similarly in structure and function whether it…

Q: How is the peptide shown named (give each 3-letter name for the amino acids present)? Whichamino…

A: The peptide is made up of amino acid. The sequence of amino acid in this peptide is N - Val-Phe-Trp-…

Q: Below is a primary sequence alignment between the wild-type hemoglobin protein, and the hemoglobin…

A: Hemoglobin can be described as a pigmented protein that forms a component of the red blood cells or…

Q: Vasopressin & oxytocin are hormones produced by the posterior pituitary gland.  Both hormones are…

A: Vasopressin, also called antidiuretic hormone, the hormone that plays a key role in maintaining…

Q: Transcribe the DNA into mRNA.  Sequence A…

A: The process of synthesis of messenger RNA with the help of DNA template strand is called…

Q: How many amino acids are in KMT2D peptide sequence?

A: Introduction  Organic substances known as amino acids have both functional groups for amino and…

Q: This is the three-letter code for the amino acid that is the most geometrically constricted amino…

A: Amino Acids are the organic compounds that combine to form proteins, hence they are referred to as…

Q: What amino acid sequence is coded by the following mRNA base sequence?

A: Genetic code is the sequence of nucleotides in deoxyribonucleic acid (DNA) and ribonucleic acid…

Q: small protein has a sequence ACNCKAAPMLCARYCAMLH. The structure of this single peptide is stabilized…

A:

Q: A sample of a peptide of unknown sequencewas treated with trypsin; another sample of the same…

A: Introduction: The chain of amino acids is known as a peptide which is connected by an amine or…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Draw a ribbon structure for the following polypeptide: (There is more than one right answer to this…

A: The polypeptide in question is likely to form intrastrand antiparallel beta-sheet. Beta-sheets are…

Q: What does tRNA stand for?

A: The central dogma is the theory explaining the process of gene expression that initiates from the…

Q: Met – Asn – Cys – Phe – Glu – Met – Leu – Arg – Ile – Asp – Glu – Gly – Leu – Arg – Leu – Lys – Ile…

A: The central dogma of molecular biology states that it is the unique nucleotide sequence in DNA which…

Q: From the above sequence I have copied the first 500bp of the sequence into Word.…

A: To design primers for amplifying the given 500bp region, we need to identify suitable regions to…

Q: Given the following DNA, (A) what is the transcript (mRNA) sequence? (B) What might be the amino…

A: Given: DNA sequence

Q: Below is the primary sequence of a viral protein.…

A: The charge of a protein is determined by the charge of individual amino acids. The charge of…

Q: The normal sequence of a protein is: Met – Thr – Lys – His – Ser – Ser ... Mutations of the DNA…

A: In this problem, the normal sequence of a protein is given, and three different protein sequences…

Q: Hello , please help me with this question. I am struggling with naming the Amino Acid sequence from…

A: Codon is the triplet of either DNA or RNA nucleotides which codes for a specific amino acid during…

Q: T/F: This reaction probably produces NADH in a cell O True CH2OH -ОН O False Н но-н Н Н -ОН -OH…

A: Few important points : Nucleic acids and proteins are informational biomolecules. Amino acids will…

Q: 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGAGTGTAATGTTTGCCTAAGGCC -3 70…

A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…

Q: For the peptide that is pictured, I am supposed to count how many amino acids there are.

A: Polypeptide chains have amino acids that are linked together via peptide linkages. The sequence of…

Q: A polypeptide is digested with trypsin, and the resulting segments are sequenced:  Val-Gly…

A: Trypsin and chymotrypsin are essential serine proteases that are secreted by the pancreas. They play…

Q: How do I determine an amino acid sequence from RNA? I know you start at AUG which is methionine…

A: To determine an amino acid sequence from RNA, the translation machinery makes use of the genetic…

Q: The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were…

A: Enzymes can catalyze several reactions and aid in speeding up a reaction. There are several enzymes…

Q: How do you translate this into amino acid sequence

A: The process of synthesis of protein with the help of messenger RNA is called translation. In the…

Q: Sequence: AAA UGG CAA Translate the sequence into the correct amino acids.   Question 2 options:…

A:

Q: A polypeptide is digested with trypsin, and the resulting segments are sequenced:…

A: Introduction: A number of enzymes catalyze the breakdown of peptide bonds at a specific site in an…

Q: figured out that the protein sequence was:   Met-Ala-Arg-Gly-Trp-Ala-Pro   Work backwards…

A: In this process first of all RNA sequence could be find out by the genetic code. Later on  sequences…