If DNA sequence is CCGACG what would be the amino acid sequence ( read from left to rig TRNA Anticodon Amino Acid GGC Proline CGU Alanine UGC Threonine CCG Glycine ACG Cysteine

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sequence shown above, identify the following: mRNA…

A: A biological process in which the information present in DNA is copied to RNA (mRNA) is known as…

Q: Pairing an anticodon with a codon requires: Covalent bonding O lonic bonds Hydrogen bonding

A: Codon is the set of three nucleotides that are present in DNA or RNA that codes specific amino…

Q: The following is a strand of mRNA: CAA GUG AAA ACA How many amino acids does the mRNA strand above…

A: The protein synthesis process requires the genetic material in the form of DNA to be transcribed…

Q: DNA MRNA Amino Acid

A: It is on the basis of centra Dogma of molecular Biology. central dogma is the process by which DNA…

Q: The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT   Give the mRNA…

A: Answer: CENTRAL DOGMA : It is the complete process of replication of DNA , transcription of DNA  and…

Q: The codon sequence corresponds most closely to the sequence of the strand. MRNA O coding DNA TRNA O…

A: Most cells contain deoxyribonucleic acid (DNA) as their genetic material. Some also have ribonucleic…

Q: The genetic message to make a  specific amino acid in a protein, is carried by a specific   three…

A: Gene is a segment of DNA (deoxyribonucleic acid)/RNA (ribonucleic acid), which codes for a protein…

Q: Which type of covalent bond is present in a “charged” transfer RNA molecule (with an amino acid…

A: Ribonucleic acid transfer (tRNA) is a type of RNA molecule that helps decode a sequence of messenger…

Q: What type of nucleic acid corresponds to the statement? CHOICES: Both ,DNA only, RNA only ,Neither…

A: Nucleic acids, DNA and RNA, are polymers (macromolecules) that are involved in heredity. The nucleic…

Q: A strand of DNA containing the repeating sequence TAC GCT TTT GCG ATAACT could code for which of the…

A: When DNA is converted into RNA then this is called transcription.  When mRNA encodes protein then…

Q: A small section of mRNA codons has the following sequence: CCU GUA CAC GUC Some Amino Acids Stop…

A: mRNA is the messenger RNA which is used as a template strand for the protein synthesis.

Q: The circled portion labeled Y is known as a(n): O ribosome O DNA molecule codon TRNA molecule O…

A: The translation occurs in the cell's cytoplasm. Firstly, a nascent mRNA or pre-mRNA synthesized by…

Q: Amino Acid Start Glycine Leucine Valine Glutamic Acid Proline C AA AAC CA A MRNA AUG C vA VA V DNA…

A: Translation is the process of synthesis of proteins from mRNA (serves as a template strand ) . Codon…

Q: Part of being a detective is being able to decode secret messages left behind by certain…

A: The given DNA sequence is: 5'- TATGCTAGGCATTGTCGTAGGCATACG -3' 3'- ATACGATCCGTAACAGCATCCGTATGC -5'

Q: RNA means: Ribonucleus Alkaline Ribonucleus Alum Ribonucleic Acid Ribonucleus Acid

A: RNA:  It is a polymeric molecule which is responsible for various biological roles such as…

Q: HO CH3 CH3 Gly Ser Gly Ala Gly Ala ZI IZ

A: The protein is formed when different amino acids are joined together by peptide bond. The peptide…

Q: Use the table below to help you answer the following question. THE CODON TABLE FIRST POSITION SECOND…

A: Ans- Tyrosine was replaced with cysteine.

Q: Which is found in DNA only?

A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each…

Q: Which of the following nucleotides found in DNA is dGTP? Note, hydrogens bound to carbon atoms are…

A: A nucleotide consists of a sugar molecule (be it RNA ribose or DNA deoxyribose) bound to a phosphate…

Q: How many possible nucleotide sequences could code for a peptide with the sequence "MRRTGERS*"? (Note…

A: The given sequence is 'MRRTGERS*'. The amino acid sequence is…

Q: The sequence of __________ in nucleic acids encodes a specific order of amino acids for making a…

A:

Q: A nontemplate strand of bacterial DNA has the base sequence 5'-ATGATACTAAGGCCC-3' Determine the…

A: The central dogma of molecular biology describes the flow of information in biological systems.  It…

Q: Which of the following amino acids is non polar at ph 7

A: Amino acids are usually polar molecules and their polarity is the result of amino group (-NH2) and…

Q: the sequence of amino acids coded for by the following sequence of bases in a strand of Jse the…

A: The final step of gene processing in which the codons of mRNA are decoded by the tRNA inside the…

Q: Translation of mRNA Using the codon chart provided, translate the following messenger RNA sequence…

A:

Q: Which of the following have codons? amino acids acetyl transferase FRNA RNA polymerase proteins TRNA…

A: The DNA is the genetic material of  the living organisms like humans. This molecule carries the…

Q: Amino Acids Cys A lanine |-CH2 SH Leucine Isaleucine Leu Ser Aspartil acia Gly Ser Leu Serine…

A: Amino acids are the building blocks of proteins. These are identified by their names or a…

Q: The codon chart is shown below, what amino acid sequence does the DNA sequence: 3' TCAGCTAGA 5' code…

A: The proteins or polypeptide chains are composed of amino acids and they are produced from the mRNA…

Q: A small section of mRNA codons has the following sequence: UGU  GGU  CAA  CCG Some Amino Acids…

A: mRNA is a ribonucleotide sequence produced as a result of transcription from DNA. Once the mRNA is…

Q: Drag and drop the following terms into the correct spots on the image below. 1. Amino Acids 2.…

A: Ribosomes are responsible for the production of proteins. They accomplish this through a process…

Q: What’s the resulting amino acid sequence? 3’CAG TTA AGC CTC GGT TAC CAG GAT ACG GGA 5’

A: Transcription: Transcription is a process where the DNA is used as a template to synthesize mRNA.…

Q: Use the codon table shown above to help answer this question. Changing a UUG codon in mRNA to a UAG…

A: Proteins are made up of amino acids in a specific sequence and if mutation occur then the sequence…

Q: The storage of glycogen in the muscles and liver in the body of a marathon runner is vital to…

A: Glycogen is a polysaccharide (having multiple branches) of glucose that fills in as a type of…

Q: Choose any pentapeptide composed of five different amino acids.  List the amino acids.  Present one…

A: INTRODUCTION In cells, messenger RNA is a molecule that transports information from the nucleus to…

Q: A mistake during DNA replication leads to a mutation in the nucleotide sequence shown below. DNA DNA…

A: Mutations are a genetic phenomenon in which alterations in the sequence of nucleotides of DNA occur.…

Q: The primary structure of a protein is ultimately determined by an MRNA molecule an FRNA molecule O a…

A: The primary structure simply means the sequence of amino acids in  a polypeptide chain. By the…

Q: Use the codon table shown above to help answer this question. An original (wild-type) mRNA sequence…

A: The changes in the nucleotide sequence of DNA or RNA is known as mutation that can alter the…

Q: Which of the following is an achiral amino acid? alanine arginine proline glycine Previous Page Next…

A: Q1 two categories represent a classification of all lipids based on their molecular structure is…

Q: Which amino acid is at the N-terminus of the following peptide? CSKWN serine O lysine tryptophan O…

A: These are the structural monomers that make up proteins.  They join together to form short polymer…