Answered: For the peptide that is pictured, I am…

Science

Biochemistry

For the peptide that is pictured, I am supposed to count how many amino acids there are.

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: What is a peptide bond and where do you find it?

A: A peptide bond is a bond present in proteins which connects two amino acids. It is a covalent bond…

Q: List two types of DNA mutations and state which one is more likely to have a severe effect on the…

A: DNA mutations are a sudden change in the DNA sequence. Mutations can be caused by various factors,…

Q: First Base U C A G Second Base G UGU Cysteine UGC Cysteine UGA Stop UGG Tryptophan U C A UUU…

A: The genetic information in the DNA is transcribed into mRNA, which is then translated into protein.…

Q: Can you show me the step how you get the amino acid sequence?

A: An amino acid sequence refers to the linear arrangement of amino acids in a protein or peptide.…

Q: A HEPTAPEPTIDE that punctures the bacterial cell wall has just been recently isolated from the venom…

A: Acid hydrolysis of any protein/polypeptide is used to identify amino acids contained in the…

Q: H,Ñ-CH-C–NH-CH-C-NH-CH-C-0 CH, CH-CH; СНОН CH, ČH; ČH;

A: The given peptide is composed of three amino acids; it can also be called tripeptide. The sequence…

Q: How do you draw different amino acids at ph 7? can you show me an example which I can follow to draw…

A: Amino acids are the building blocks of proteins. They are organic compounds that contain a carboxyl…

Q: How many amino acids are in KMT2D peptide sequence?

A: Introduction Organic substances known as amino acids have both functional groups for amino and…

Q: what is not an aminoglycoside?

A: Aminoglycosides are a class of anti-infection agents utilized widely in the treatment of aerobic…

Q: This is the three-letter code for the amino acid that is the most geometrically constricted amino…

A: Amino Acids are the organic compounds that combine to form proteins, hence they are referred to as…

Q: Are there anymore features that limit the protein configurations?

A: A protein's biological function depends on its three-dimensional structure. The 3D structure is…

Q: There are 20 naturally occurring amino acids. Each one has distinct properties and roles. Drawn is…

A: Lysine has 3 ionizable groups. They are an alpha-carboxylic acid group (highlighted in BLUE) , an…

Q: What is BP ? My BP is 100/150 . is it good or bad for my health ?

A: KEY WORDS :- BP - Blood pressure. Normal blood pressure - 120/80 MMHG.

Q: I was given an amino acid position 564 with the PDC code 2V1X. Would it be possible to describe why…

A: A mutation is a change in the DNA sequence of an organism. Mutations can be caused by errors in DNA…

Q: Name Lysine Arginine Histidine Aspartate Glutamate Structure 1-Let Abbr 3-Let Abbr Class Special…

A: Amino acids are organic compounds that form the building blocks of proteins in cells. The structure…

Q: Which amino acids are in the figure?

A: Amino acids are the building blocks of proteins. They are organic compounds made up of an amino…

Q: You are trying to purify Protein 1 from a mix of 4 different proteins without denaturing the…

A: Ion exchange chromatography is a techniques that separates ions and polar molecules based on their…

Q: Explain how the spectroscopic properties of amino acids can be used to quantify protein using UV…

A: Proteins are polymers of amino acids. The sequence of amino acids determines the shape, properties,…

Q: I would like a explanation or flow of information about the Central Dogma. Include describing the…

A: Central dogma The biological information flows through genes. DNA is the main genetic material of…

Q: how chemical bonding stabilizes a specific secondary structure element that is present in your PDB…

A: The protein coded as 3GRS is glutathione reductase.

Q: How many amino acids are in the following peptide? H₂N H3C ZI CH3 IZ O=C CH3 `N H HH OH | LOH

A: A polypeptide chain constitutes of amino acids are linked together via peptide bonds. The proteins…

Q: The pK values for Lysine are 1.92/9.99/13.8. At what pH will the amino acid not migrate in an…

A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…

Q: II. Draw the different forms of the following amino acids in solution. 1. Proline (3 forms) 2.…

A: Amino acids are basic unit of polypeptide chain. Alpha carbon of amino acids contains carboxyl…

Q: HO, NH2 HO This amino acid is called It's three-letter abbreviation is and its one-letter…

A: Proteins are the building blocks, made up of amino acids. They are of twenty different types that…

Q: When answering the questions below, please use the ONE-LETTER CODE for the amino acid, with NO…

A: The determination of primary structure of a protein is crucial since the sequence of the protein…

Q: 1. What is the N-terminal AA residue? 2. What is the C-terminal AA residue? 3. What is the sequence…

A: Aminoacids are organic compunds. that combine to form protein. Amino acid is formed when a central…

Q: For each amino acid, show the structure, 1-letter abbreviation, 3-letter abbreviation, class…

A: Amino acids are the fundamental building blocks of life. They are the essential components of…

Q: What is the GLOBULAR PROTEIN as the classification of proteins based on shape or conformation

A: The macromolecules formed of amino acids linked by peptide bonds are called proteins. They are…

Q: There are 22 amino acids used within the human body. How can these 22 molecules be used to make…

A: Amino acids are monomers of proteins.

Q: What is the difference between sickle-cell amino acid sequence and normal amino acid sequence?

A: Sickel-Cell anaemia is a blood disorder in which the specifically the Red Blood Cells becomes…

Q: At pH 1, the charge on the side chain of Arg is

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: How do you translate this into amino acid sequence

A: The process of synthesis of protein with the help of messenger RNA is called translation. In the…

Q: Proteins are essential to most processes in the human body. Given your understanding of the M phase…

A: Cell Cycle and Phases Of Cell Cycle ---- The ordered sequences of events which takes place in the…

Q: Please help me fill out this worksheet

Q: Which amino acid is NOT associated with the oligopeptide given by the shorthand notation GRFAV?…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: You could use absorbance at 280nm or colorimetric assays like the Bradford assay or bicinchoninic…

A: There are different methods present to measure the concentration of a given protein.

Q: what is the correct way of drawing a peptide backbone?

A: A peptide is a polymer of amino acids. In a peptide, 2 amino acids are linked to each other via a…

Q: A B Amino Acid Lysine Abbreviation 3- Letters Lys 1- Letter K pk₁ -COOH 2.18 pK₂ -NHS* 8.95 PKR R…

A: Amino acids are biomolecules where an alpha carbon is bonded to an amine group , a carboxylic group,…

Q: A HEPTAPEPTIDE that punctures the bacterial cell wall has just been recently isolated from the venom…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: I-D-E-L-Y-S-Q-V-C-S-H-L-D-T-V-R The amino acid sequence above forms an alpha helix. Place the amino…

A: The alpha helix is a secondary protein structure which is a right-handed helix individually…

Q: HO 0 0 NH₂ НО.

A: The fundamental building blocks of proteins are called amino acids, which are made up of one…

Q: Which is the amino acid represented below? I H₂N O OH

A: The building components of protein are amino acids. Long strands of amino acids make up proteins.…

Q: how many amino acids are in CAGATTGTGAAGAGGTCTCTTGA peptide sequence? Answer in numerical digits…

A: The DNA acts as the genetic element in most organisms. The genes are transcribed in mRNA. mRNA so…

Q: pH @1 of Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr

A: Peptides are organic compounds made up of amino acids connected by peptide bonds. The specific…

Question

100%

Hello,

For the peptide that is pictured, I am supposed to count how many amino acids there are. I selected 3, and was incorrect.

Choices:

1, 2, 4, 5, 6

Thank You

H2N
–3C
Н
ZI
CH3
IZ
0=0
I
`N
ОН
CH3
НН
ОН

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

What does the “=“ mean when used in a macromolecule when written out.
Uzair has two protein sequences, he want to check their similarities what he will do? What results are expected
A polypeptide is made up of ten isoleucines, then ten tyrosine, and lastly one glutamic acid. What characteristics is this peptide likely to have based on its amino acid composition?
Thank you
Please help me with this question need the answer within an hour urgently
None
Please find all 5 mistakes and provide corrections for all 5 mistakes
What does the acronym AGP represent?
PLEASE HELP How many stereoisomers or ribose are there?
Which protein did you make? Give its name and tell what it does.
Thank you very much for your assistance as it is greatly appreciated.
Please type out answer and need 200 word or more response Propose a reason for why so many of the essential amino acids belong in the aliphatic and aromatic groups.