Can you please help me determine how many Amino Acids are in this picture, and how?Thank You!!! How many amino acids are in the following peptide?H₂NZIH3C CH3IZHOHCH3HHLOH

A polypeptide chain constitutes of amino acids are linked together via peptide bonds. The proteins…

Answered: How many amino acids are in the…

Science

Biochemistry

How many amino acids are in the following peptide? H₂N H3C ZI CH3 IZ O=C CH3 `N H HH OH | LOH

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: Please identify whether the statements below is true or false. Thank you! (Please put a short…

A: Amino acids are compounds containing carbon, hydrogen, oxygen, and nitrogen. Proteins are polymers…

Q: What is a peptide bond and where do you find it?

A: A peptide bond is a bond present in proteins which connects two amino acids. It is a covalent bond…

Q: Why is it no longer considered necessary to determine the Nterminal amino acid of a protein as a…

A: N-terminal amino acid : The N-terminal is the start of a protein or polypeptide referring to the…

Q: What do you mean by acylation?

A: The translation is the process by which the information stored in mRNA is converted into a…

Q: 2. You are in a South American rain forest looking for naturally occuring peptides with potential as…

A: Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: 1. Subunit Composition of a Protein A protein has a molecular mass of 400 kDa when measured by gel…

A: Gel electrophoresis is a laboratory method that can be used for sorting protein mixtures by…

Q: 23: Vmax, the maximum velocity, of an enzyme-catalyzed reaction is: A) The rate observed when all…

A: In living beings there are a complex nitrogen-containing molecules are called enzymes. These…

Q: The Primary Structure of a Protein Is Its Linear Arrangement of _____________

A: . The primary structure of the protein is linear, and covalent peptide bonds are present between…

Q: A HEPTAPEPTIDE that punctures the bacterial cell wall has just been recently isolated from the venom…

A: Acid hydrolysis of any protein/polypeptide is used to identify amino acids contained in the…

Q: Why is it more difficult to determine the structure of the oligosaccharides compared to amino acid…

A: Carbohydrates are the sugar molecules that play an important role in providing energy to the human…

Q: H,Ñ-CH-C–NH-CH-C-NH-CH-C-0 CH, CH-CH; СНОН CH, ČH; ČH;

A: The given peptide is composed of three amino acids; it can also be called tripeptide. The sequence…

Q: What is the optical property of amino acids?

A: Amino acids, which are made up of carbon, nitrogen, oxygen, and hydrogen, as well as the side chain…

Q: what is not an aminoglycoside?

A: Aminoglycosides are a class of anti-infection agents utilized widely in the treatment of aerobic…

Q: Using whatever source you have, give the (hand-drawn, Haworth format) structural example of a…

A: A monosaccharide is a simple sugar that constitutes the building blocks of a complex form of sugars,…

Q: A nucleotide is made up of 3 parts: A _______________ and a _________________ that form the…

A: A nucleotide is the repeating unit of nucleic acids.

Q: What is Norit? What is it made of? What is it used for?

A: 1.What is Norit..... Ans. Norit is a Activated carbon, also called activated charcoal, is a form of…

Q: There are 20 naturally occurring amino acids. Each one has distinct properties and roles. Drawn is…

A: Lysine has 3 ionizable groups. They are an alpha-carboxylic acid group (highlighted in BLUE) , an…

Q: A. How many ATP's could theoretically be produced when a granule of glycogen is hydrolyzed to…

A: Glycogen is the storage form of glucose in the body localized in the liver. Glycogen is a highly…

Q: I was given an amino acid position 564 with the PDC code 2V1X. Would it be possible to describe why…

A: A mutation is a change in the DNA sequence of an organism. Mutations can be caused by errors in DNA…

Q: Locate the parts of the amino acids that participate in the chemical reaction that links the amino…

A: Amino acids:Amino acids can be defined as the organic compounds which contain functional groups (an…

Q: Which amino acids are in the figure?

A: Amino acids are the building blocks of proteins. They are organic compounds made up of an amino…

Q: Draw a skeletal structure for OCTADECANOIC ACID. A triglyceride contains thre octadecanoic acids as…

A: We'll answer the first question since the exact one wasn't specified. please submit a new question…

Q: How lactulose works Or write the mode of action of lactulose? Please answer at your own words.

A: Lactulose plays a key role in managing patients with Hepatic encephalopathy wherein Ammonia levels…

Q: Amino acids and hoteins - Diseuss

Q: Draw serine at physiological pH. Include all hydrogen atoms. H. - H,N - H | |

A: Serine at physiological pH (pH=7.4) exist as zwitter ion.

Q: Explain how the spectroscopic properties of amino acids can be used to quantify protein using UV…

A: Proteins are polymers of amino acids. The sequence of amino acids determines the shape, properties,…

Q: I would like a explanation or flow of information about the Central Dogma. Include describing the…

A: Central dogma The biological information flows through genes. DNA is the main genetic material of…

Q: The pK values for Lysine are 1.92/9.99/13.8. At what pH will the amino acid not migrate in an…

A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…

Q: Determine whether each side-chain of the following amino acids is polar and neutral, nonpolar,…

A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…

Q: Outline the steps in the biosynthesis of the following: a) Pyrimidine nucleotide b) Heme 6.

A: Biosynthesis is a multi-step process, an enzyme-catalyzed process in which substrates are…

Q: HO, NH2 HO This amino acid is called It's three-letter abbreviation is and its one-letter…

A: Proteins are the building blocks, made up of amino acids. They are of twenty different types that…

Q: 1234 1. 2. 3. 4. What is the name of the monomer that all proteins are comp What are the predominant…

A: Hi! Thank you for the question. We are authorized to answer subparts of one topic at a time, since…

Q: Below is a graphic with 8 blanks. Please assign each arrow a number corresponding to the words in…

A: DNA (deoxyribonucleic acid) is the genetic material in living organisms that is composed of two…

Q: 1. What is the N-terminal AA residue? 2. What is the C-terminal AA residue? 3. What is the sequence…

A: Aminoacids are organic compunds. that combine to form protein. Amino acid is formed when a central…

Q: You are setting up a dideoxysequencing reaction. What is the correct ratio of dNTPS…

A: The dideoxy method of sequencing is also known as Sanger sequencing. It is a method of DNA…

Q: Please help me fill out this worksheet

Q: What is the acid-base property of amino acids? Please do not plagiarize from the internet and…

A: Amino acids are the constituents of protein molecules. As the amino acids in their basic structure…

Q: 1. Sephadex G100 is (a) a carbohydrate polymer, (b) used to isolate lectins, (c) is the stationary…

A: Sephadex is a type of dextran used in : Protein chromatography Gel filtration Affinity…

Q: An amino acid always has an amino group, as its name suggests. What other group is also present in…

A: Amino acids are the building block of proteins. They are connected by peptide linkages. Proteins…

Q: Draw a linear disaccharide of glucose. is an alternating alpha (1-4) and b (1-4) linkages energy…

A: Introduction:- The question is all about the structure of glucose that are isomers of each other as…

Q: Our growing understanding of how proteins fold allows researchers to make predictions about protein…

A: The proteins are composed of twenty standard amino acids that differ from each other on the basis of…

Q: Could you help me with these questions, please? My teacher will not help me. Thanks so much!! 1)…

A: DNA known as Deoxyribonucelic acid is a nucleic acid and Keratin is a protein found in hairs. A…

Question

100%

Can you please help me determine how many Amino Acids are in this picture, and how?

Thank You!!!

How many amino acids are in the following peptide?
H₂N
ZI
H3C CH3
IZ
H
OH
CH3
HH
LOH

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

I try to prepare for my biological chemistry exam, so I will appreciate if the answer is with some details. And I will be happy if there would be explanation for when I should use wich of the pka's. Thank you so much.
DO NOT COPY OLDER ANSWERS! AND SHOW FULL WORK! I have a mixture of 4 proteins, whose sequences are shown below (note that each protein is a 100-repeat of the sequence shown). Protein A: (Gly-Ala-Lys-Val-Ile-Phe-Glu-Val-Asn-Gly) Protein B: (Ala-Ala-Lys-Arg-Ile-His-Glu-Ala-Asn-Lys) Protein C: (Glu-Val-His-Asp-Ala-Asp-Glu-Val-Asn-Asp) Protein D: (Ala-Lys-Arg-Phe-Trp-Phe-Gly-Ile-Ala-Gly) 1) Which protein/s are MOST LIKELY to precipitate out at a pH of 3.5? a) A b) B c) C d) D e) B & C f) A & D g) None of them h) Cannot be determined.
A HEPTAPEPTIDE that punctures the bacterial cell wall has just been recently isolated from the venom gland of a frog. Amino acid analysis of the peptide reveals the following information below: (NOTE: when the sequence is not known, a comma separates the amino acids) Hydruzine Acid Hydrelysis (6 N NC)ot 110°C Heptapeptide (2) Arg. Pro, Phe, Tyr, Ala, Lys 2,4-dinitrefluorobenzene DNP-Phe Lys and modified free Peptide 1 (Ala, Lys) amino acids Cleavage with Trypsin, then chrometegraphy Peptide 2 (Pro, Arg, Tyr) Peptide 3 (Phe, Arg) Phe (leavege with (hymotrypsin, then chromotogrophy Peptide 4 (Arg, Tyr) Peptide 5 (Lys, Pro, Ala, Arg)
_____________ are degrons with sequences containing proline, glutamate, serine, and threonine residues.
What do you mean by aminon? State its function.
OalaMX Macron X E Macror x AlpQLScizmoeop5-4WA3yY20Vic8quirEip1r7NLKxf_bQYVnQYcjA/viewform?edit2-2 ABa proteins lipids nucleic acids carbohydrates The storage of glycogen in the muscles and liver in the body of a marathon runner is vital to providing the most preferred source of energy needed. Which the following meals would provide the best glycogen storage? * baked potato, bread, and pasta fruit salad and broccoli cheese soup fried chicken, cheese sticks, and gravy steak and eggs Glycogen is a polysaccharide of which type of macromolecule? allows FILL OUT A NEW
Discuss about Amino Acid Analysis ?
Can you explain the various options and how did you come to the answer? How to identify them when they are like that?
how many amino acids are in CAGATTGTGAAGAGGTCTCTTGA peptide sequence? Answer in numerical digits only
Please help me understand and answer the following.
I need the answer as soon as possible
Please don't provide handwriting solution