1) Assembling a genome after whole genome shotgun sequencing is substantially complicated by the presence of repetitive elements in the genome. What is the main challenge such repetitive elements cause in the process of genome assembly? 2) Identify and explain the two main sequencing methods available for overcoming the challenges in genome assembly presented by repetitive elements. Explain why one produces numerous “gaps” in the resulting assembly, but the other does not.

Q: collaborators have successfully sequenced and characterised the entire genome of the newly…

A: The DNA is a very very huge molecule which is packed inside the nucleus. The analysis of DNA…

Q: With a few exceptions, interspersed repetitive DNA in the human genome has no known biological…

A: Human genome: The term human genome refers to the complete set of genetic instructions or DNA that…

Q: Recombination signal sequences are conserved heptamer and nonamer sequences that flank the V, J, and…

A: Introduction: RAG 1 & 2 are the recombination activating genes that encode a portion of a…

Q: About 60% of the base pairs in the human genome are AT. If the human genome has 3.2 billion base…

A: The base composition of the genetic material is the same in all the species present on earth. The…

Q: If a pair of 10-mer primers are used in a PCR, what would be the number of expected binding sites in…

A: PCR is a polymerase chain reaction, in this process DNA is amplified . For this amplification,…

Q: What is the role of Mg2+ in genomic DNA extraction?

A: DNA extraction refers to the method of isolating and purifying DNA from a cell. It involves…

Q: 2) The partial coding sequence of the Spike protein for SARS- COV-2 is shown below: You are tasked…

A: The answer is option A  In the PCR amplification, two primers are used to flank the target region to…

Q: Why do geneticists studying eukaryotic organisms often construct cDNA libraries, whereas…

A: A cDNA (complementary deoxyribonucleic acid) library is a combination of cloned cDNA fragments…

Q: Why the DNA sequencing alone is often not sufficient to produce a genome assembly of desired…

A: DNA sequencing is basically the process by which the nucleic acid sequence can be determined. the…

Q: Draw a representative agarose gel showing the bands, and the direction of current flow as well point…

A: EcoR1 is a restriction enzyme that can cleave a dsDNA at the sequence GTTAAC. They cleave the cite…

Q: The following illustrates a jagged double-strand DNA break resulting from Cas9 cleavage that…

A: "Investigating the results of DNA repair through non-homologous end joining (NHEJ) following Cas9…

Q: Draw roughly the comparative electrophoretic mobilities of close circular DNA, open circular DNA and…

A: Since there are multiple question asked in this particular question, I will answer the first one for…

Q: About 60% of the base pairs in the human genome are AT. If the human genome has 3.2 billion base…

A: An enzyme produced from the bacteria which recognizes specific base sequence in DNA and cut the DNA…

Q: Consider a genome whose length is 1000 bp. "Shotgun" sequencing techniques are applied to the…

A: Shotgun sequencing is an important tool in modern genomics that allows researchers to interpret the…

Q: The 3′-exonuclease activity of E. coli DNA polymerase I was found to show no discrimination between…

A: Introduction: DNA is the type of nucleic acid that is the genetic material of the living body,…

Q: 1) polymerize chain reaction is an experimental method for making multiple copies of segments of DNA…

A: Questions :    1) polymerize chain reaction is an experimental method for making multiple copies of…

Q: You obtain the DNA sequence of a mutant of a 2-kb gene in which you are interested and it shows base…

A: the mutation is the change or error that is caused in the chromosome it is of a different type 1.…

Q: While comparative genomics is fundamentally the study of the differences between the genomes of…

A: Comparative genomics is the study of genetics and other elements of biology by comparing the genomes…

Q: For insertion elements and simple transposition, what is the function of the inverted repeat…

A: Transposition A transposon also called a jumping gene is the DNA sequence that changes its position…

Q: Repeated sequences can be classified according to theirorganization in the genome as well as…

A: The heredity or inheritance is defined as the passing of traits from parents to their offspring. The…

Q: Researchers are manipulating the gene cxx2 for their experiments, and they have inserted a small…

A: As per the central dogma of biology, the flow of genetic information is from DNA -> RNA ->…

Q: In generating mutations in a bacterial gene involved in antibiotic resistance, a number of point…

A: Mutations are unexpected and unforseen alterations takes place inside the genetic material of an…

Q: Some synthetic biologists have proposed creating an entirely new, freeliving organism with a minimal…

A: A genome is the entire DNA collection of an organism, including all genes. All the details needed to…

Q: A piece of DNA 5.0 kb long is cloned and then cut out of the vector for analysis. This linear piece…

A: Restriction enzyme is any enzyme that cleaves DNA at a particular sequence. Example - BamHI, EcoRI,…

Q: Transposon mutagenesis

A: Transposons: These are also known as jumping genes. These are the segments of DNA which can move or…

Q: You know from your calculationsthat only a small proportion of the human genome is represented, even…

A: The objective of the question is to outline a strategy for constructing a genomic DNA library that…

Q: The figure below shows the recognition sequences and cleavage positions of three restriction…

A: Restriction enzymes are those that have a tendnecy to cut the strands of DNA straight. This leads to…

Q: To generate large amounts of DNA to manufacture gene therapy payloads or to be able to see them on…

A: Specific sequences can be amplified by PCR in order to generate large amounts of DNA to manufacture…

Q: The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product…

A: Agarose gel electrophoresis used to separate DNA according to its molecular weight. On agarose gel,…

Q: 3a)ClustalX software was used to perform multiple sequence alignment of the following five Nco…

A: Some frequently performed analysis via bioinformatics are DNA sequence analysis, amino acid…

Q: You wish to align a 300 bp nucleotide sequence to a genome. Which of the following pairwise sequence…

A: Pairwise sequence alignment is a fundamental process in bioinformatics that includes aligning two…

Q: Can you help with 1a please HELPFUL INFORMATION: When performing classical Sanger or "dideoxy"…

A: Sanger sequencing is done to identify the sequence of DNA. In this process, a particular ddNTP is…

Q: The authors investigate if the switch from the polymerase to the exonuclease site involves releasing…

A: During DNA replication, accuracy is determined by rate of nucleotide incorporation by DNA…

Q: Genome annotation refers to ... 1.) lining up overlapping regions in short shotgun sequencing reads…

A: Introduction:- Genome consists of all the genetic and biological information of an individual…

Q: functionalization of a sensor array with DNA oligonucleotide capture probes for ribosomal RNA (rRNA)…

A: (B)The method which is based on sandwich hybridization of a capture and a detector probes with…

Q: b) A gene was isolated from mouse and sequenced by a research group. When the sequencing result was…

A: BIOINFORMATICS is an interdisciplinary field of Biology and Technology that involves the usage of…

Q: Eukaryotic genomes are replete with repetitive sequences that make genome assembly from…

A: Tandem repeats of the dinucleotide sequence are the repetitive sequences that are found at many…

Q: CRISPR/Cas9 mediated genome editing has provided an unparalleled means of manipulating the genome.…

A: CRISPR/Cas9 (Clustered regularly interspaced short palindromic repeats/CRISPR-associated genes) is a…

Q: Define CRISPR (clustered regularly interspaced short palindromic repeats)

A: CRISPR is sequences of DNA found in prokaryotes such as archaea or bacteria. These clustered DNA…

Q: A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid…

A: Plasmids are small, circular, double stranded, and extrachromosomal bacterial DNA. i.e. it is…

Q: Consider the following human genetic diseases: hemophilia, Down syndrome, cystic fibrosis, and brain…

A: CRISPR(Clustered Regularly Interspaced Short Palindromic Repeats) Cas genome editing technology…

Q: An optimum ligation reaction should contain approximately 50 ng of vector. Given your concentrations…

A: It is given that an optimum ligation reaction should contain approximately 50 ng of the vector. We…

Q: The exponential nature of PCR allows spectacular increases in the abundance of a DNA sequence being…

A: DNA is the chemical name for the molecule that carries genetic instructions in all living things.

Q: This is from the Wilson et al. article.

A: Primer PC3mod (PURPLE)Recognition sequence: 5' TGCCAGCGAGTCAAGTCGGGAACTCT 3'Direction of…

Q: The exponential nature of PCR allows spectacular increases in the abundanceof a DNA sequence being…

A: Polymerase chain reaction, or PCR, is a technique to make many copies of a specific DNA region in…

Q: DNA polymerase I (Pol I) of E. coli consists of three functional parts (domains): an N-terminal…

A: Introduction: Synthesis of DNA requires the RNA primers to start the addition of…

Q: After Drosophila DNA has been treated with a restrictionenzyme, the fragments are inserted into…

A: Cloning is a particular technique scientists use to make exact genetic copies of living organisms.…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.