Repeated sequences can be classified according to theirorganization in the genome as well as according to theirfunction. Give at least two examples of each.
Q: A microbiologist discovers a new type II restriction endonuclease. When DNA is digested by this…
A: Restriction enzymes are also known as molecular scissors because they cut the DNA at specific, short…
Q: List and describe three important processes are affected by DNA supercoilin
A: DNA supercoiling is reffered to as under or "overwinding' of DNA strands. It is a crucial process in…
Q: Let’s say that a stretch of repeated AT issuccessfully sequenced. From what you know of the…
A: Sequence assembly involves the alignment and merging of fragments from a DNA (deoxyribonucleic acid)…
Q: Below is a sequence of DNA.…
A: Introduction :- Adenine (A), thymine (T), cytosine (C), and guanine (G) are four nucleic acid bases…
Q: What is the role of di-deoxy DNTPs in a Sanger sequencing reaction? Please select the answer that…
A: Sanger sequencing is a method which helps in termination of chain and determining the nucleotide…
Q: How big (in base pairs) is (are) the fragments generated by digesting the vector with EcoRI
A: Base pairs - there are four bases or nucleotides in DNA: ADENINE, CYTOSINE, GUANINE, and thymine.
Q: List essential components required for the DNA sequencing reaction based on the Sanger method.…
A: DNA sequencing is the process of determining the sequence of nucleotides in a piece of DNA. In…
Q: Propose a method for isolating a DNA fragment that is adjacent in the genome to a previously…
A: Deoxyribonucleic acid is a particle made out of two polynucleotide chains that loop around one…
Q: Why the DNA sequencing alone is often not sufficient to produce a genome assembly of desired…
A: DNA sequencing is basically the process by which the nucleic acid sequence can be determined. the…
Q: Explain why genomic DNA libraries require more coloniesthan are contained by a single genome…
A: A set of cells that together contains an organism’s whole genome that is cut into DNA fragments is…
Q: Describe the basic structural features of DNA-binding proteins that allow them to recognize specific…
A: DNA binding proteins are proteins that have DNA binding domains and thus have a specific or affinity…
Q: You want to make a library with DNA fragments averaging over 100 kb in length. Which vectors…
A: A genomic library is a constitutive collection of the total genome of a single organism. Genomic…
Q: DNA primase synthesizes a short RNA primer that later appears at the 5'-end of each Okazaki…
A: The given statement is TRUE
Q: Your PhD thesis advisor has given you the task of preparing a human genomic DNA library. 3a. How…
A: The length of the human genome is approximately 3.2 billion bases with genes of 20000-25000 protein…
Q: Calculate the expected number of times that a given 8-base-pair DNA site should be present in the E.…
A: A bacterial genomic DNA resides inside cells in a highly condensed and functionally organized form…
Q: Terminal-sequencing reads of clone inserts are a routinepart of genome sequencing. How is the…
A: The whole-genome shotgun (WGS) method used for sequencing the DNA from the pool of many fragments by…
Q: Design a pair of primers (22 nucleotides long each) for the following sequence to clone the full…
A: Primer is a short nucleic acid sequence that provides a starting point for DNA synthesis. It is used…
Q: Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving…
A: Genomic Libraries are a set of collections of genomic DNA data particular to a species/organism. The…
Q: Variable number of tandem repeats (VNTRs) in the DNA molecule are highly useful in.......
A: Solution - Variable number of tandem repeats (VNTRs) in the DNA molecule are highly useful in DNA…
Q: That's the result of Gel electrophoresis of genomic DNA ( Of genomic DNA extraction experiment),…
A: Agarose gel electrophoresis is mainly used for nucleic acid separation due to its large pore size…
Q: Which vectors can be used to clone a continuous fragment of DNA with the following lengths? a. 4 kb…
A: According to the question, we have to mention the name of the vectors that can be used to clone a…
Q: Examine the sequence for the DNA fragment below. Your job is to design primers for PCR that would be…
A: A primer may be a brief single-stranded nucleic acid utilized by all living living beings within the…
Q: Which one of the following statements is FALSE? O There could be several possible local alignments…
A: A sequence alignment is a technique of arranging DNA, RNA, or protein sequences in order to find…
Q: Dideoxysequencing relies on which one of the following choices: A):Random stopping of one of many…
A: Introduction :- Dideoxysequencing is used in sanger sequencing. Sanger sequencing is a DNA…
Q: What is an Okazaki fragment? In which strand of replicating DNA are Okazaki fragments found? Based…
A: DNA (Deoxyribonucleic acid) is the genetic material, which gets copied during cell division. The…
Q: 3a)ClustalX software was used to perform multiple sequence alignment of the following five Nco…
A: Some frequently performed analysis via bioinformatics are DNA sequence analysis, amino acid…
Q: What advantages do cDNA libraries provide over genomic DNA libraries? Describe cloning applications…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: The prevalence of highly repetitive sequences seems rather strangeto many geneticists. Do they seem…
A: A tandem repeat is a sequence of two or more DNA base pairs that are repeated in such a manner that…
Q: DNA isolated from an organism can be sheared into fragments of uniform size (∼1000 bp), heated to…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…
Q: Ruwaifa want to compares a nucleotide query sequence what option he will opt in BLAST and why?
A: BLAST is Basic local alignment search tool used to compare the queries in a DNA database. They are…
Q: "Complementary DNA (cDNA) libraries offer certain advantages over genomic libraries". Explain how ?
A: Introduction The cDNA library is a collection of mRNA segments cloned into independent vector…
Q: The optimal design of primers is critical to the effective amplification of DNA sequences. i)…
A: INTRODUCTION Polymerase chain reaction (PCR) is a method widely wont to rapidly make millions to…
Q: When the cDNA was sequenced by the Sanger method utilizing ddCTP, the following products were…
A: Answer :: If the dCTP was not present, the polymerization would come to a standstill, resulting…
Q: Variable number tandem repeats (VNTRs) are repeating DNA sequences of about 15–100 bp in length,…
A: Forensic science. Criminological science is the use of science to criminal and common laws,…
Q: In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into…
A: Genome of an organism includes all the cellular DNA of the organism; including nuclear, chloroplast…
Q: The exponential nature of PCR allows spectacular increases in the abundanceof a DNA sequence being…
A: Polymerase chain reaction, or PCR, is a technique to make many copies of a specific DNA region in…
Q: Why the concept of a DNA library is still important for a number of modern applications ?
A: A DNA library can be described as the collection of DNA fragments that are kept and propagated in a…
Q: Suppose that a replicative DNA polymerase had its 3′ exonuclease site 1.5 nm from the polymerase…
A: A DNA polymerase is a member of a family of enzymes that catalyze the synthesis of DNA molecules…
Q: In large-genome sequencing projects, the initial data usually reveal gaps where no sequence…
A: Primer walking or directed sequencing is a sequencing method for sequencing DNA fragments that are…
Q: Based on the sequence data below. Which of the indicated sections of the sequence can you trust to…
A: DNA (Deoxyribonucleic acid) sequencing is an essential component of molecular biological studies.…
Q: HgaI recognizes a specific 5 bp sequence. How frequently would you expect a specific 5 bp sequence…
A: Restriction enzymes are the molecular scissors and are used to cut at a specific site. These are…
Q: All the DNA extraction protocols suggest adding salts to the extraction buffer. What is the role of…
A: * Dna extraction can be done in following steps Breaking cells to release the DNA Separating DNA…
Q: Describe the proofreading activity of DNA polymerase.
A: Although DNA polymerase is a very effective enzyme, it can potentially introduce an erroneous…
Q: Explain how a multiple sequence alignment can identify functional sites in a genetic sequence.
A: Sequence alignment can be defined as the pattern of arranging the sequences of DNA, RNA, or protein…
Q: AAGTCAAGAAGAAGAAGAAGCC A. The nucleotide sequence above is a STR of how many repeats? B. What…
A: Short Tandem Repeats(STR) or microsatellites or simple sequence repeats(SSR) are short sequences of…
Q: A student is running gels to sequence a DNA fragment as below. In addition to running four…
A: Sanger's sequencing method. It is a method based on DNA synthesis. In normal DNA synthesis,…
Q: Kpn I and Acc 65I are restriction enzymes that identify and cleave the same 6-bp sequence. The…
A: Introduction: Enzymes are the proteins that operate as biological catalysts, increasing the pace of…
Repeated sequences can be classified according to their
organization in the genome as well as according to their
function. Give at least two examples of each.
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- With a few exceptions, interspersed repetitive DNA in the human genome has no known biological function. Explain in a few sentences what interspersed means. Name and describe one interspersed repetitive element. Provide information on about how much of the human genome consists of this one repetitive element (copy number and/or percent of genome).DNA isolated from an organism can be sheared into fragments of uniform size (∼1000 bp), heated to separate the strands, then cooled to allow complementary strands to reanneal. The renaturation process can be followed over time. Explain why the renaturation of E. coli DNA is a monophasic process, whereas the renaturation of human DNA is biphasic (an initial rapid phase followed by a slower phase).The complementarity of its two strands is the underlying reason that DNA can be faithfully copied. Propose alternative chemical structures that could be faithfully copied.
- How many binary sequences of length n contain at most five 1 digits? The genetic code specifies an amino acid through a sequence of three nucleotides. Each nucleotide can be of one of the four types T, A, C and G, beingrepetitions allowed. How many amino acids can be encoded in this way?And if there are n types. CompareCalculate the expected number of times that a given 8-base-pair DNA site should be present in the E. coli genome. Assume that all four bases are equally probable. Repeat for a 10-base-pair site and a 12-basepair siteIn the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertion
- Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'Consider a genome whose length is 1000 bp. "Shotgun" sequencing techniques are applied to the genome, resulting in 20 reads, with an average length of 50 bp. A very important point is that, even though 20×50 = 1000, there is no guarantee that ALL 1000 bp of the genome are represented in the fragments. Calculate the coverage. What does this value mean? Why would it be a good idea to have a coverage greater than 1?Supercoiled DNA is slightly unwound compared to relaxed DNA and this enables it to assume a more compact structure with enhanced physical stability. Describe the enzymes that control the number of supercoils present in the E. coli chromosome. How much would you have to reduce the linking number to increase the number of supercoils by five?
- proteins can interact with DNA through relatively weak forces, such as hydrogen bonds and can der Waals interaction, as well as through stronger electrostatic interactions such as ion pairs. Which types of interaction predominate for sequence specifics DNA binding proteins and for sequence independent binding proteins?Variable number tandem repeats (VNTRs) are repeating DNA sequences of about 15–100 bp in length, found both within and between genes. Why are they commonly used in forensics?In a typical microbiology laboratory, reasons for no bands from a gel of a polymerase chain reaction may be due to errors relating to omission of ingredients in the reaction mix and absence of the target sequence in the template DNA. Based on (i) primer problem and (ii) purity/potential contamination of the target sequence, explain the reasons for non-appearance on bands.
![Biology: The Dynamic Science (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)
![Biology: The Dynamic Science (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)