A student is running gels to sequence a DNA fragment as below. In addition to running four sequencing reactions with the requisite ddNTPs, they also include four ‘mystery’ reactions representing variants of the first sequencing lane (using ddATP to sequence T in the template) in which one or more components of the reaction have been omitted or inappropriately added. Give a possible explanation for the what was inappropriately added/omitted in each mystery lane. Note two important things: firstly, even if everything works perfectly there is still always some unextended primer in a reaction. Secondly, there may be more than one possible explanation for some lanes; just give one.
A student is running gels to sequence a DNA fragment as below. In addition to running four sequencing reactions with the requisite ddNTPs, they also include four ‘mystery’ reactions representing variants of the first sequencing lane (using ddATP to sequence T in the template) in which one or more components of the reaction have been omitted or inappropriately added. Give a possible explanation for the what was inappropriately added/omitted in each mystery lane.
Note two important things: firstly, even if everything works perfectly there is still always some unextended primer in a reaction. Secondly, there may be more than one possible explanation for some lanes; just give one.
![Sequenced A C G T
Template T G C A
Longer
Full length
Shorter
Unextended primer
5' AGATAGCGCTAGCGATACCGAGG 3'
3' ТСТАТСGCGATCGCTATGGCTCC 5'
Mystery 4
Mystery 2
I Mystery 1
G0 d19pp+ I ||
||
IL|||
CG dIOPp+||
I || |
II|I](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2Fd3fe69db-7bbf-4899-92d9-29ce14fe3e83%2Ffa75ee1d-5111-40b9-a67d-a55cf5512cd0%2F54r39j_processed.png&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
![Human Anatomy & Physiology (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Human Anatomy & Physiology (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Molecular Biology of the Cell (Sixth Edition)](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
![Laboratory Manual For Human Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
![Inquiry Into Life (16th Edition)](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)