AAGTCAAGAAGAAGAAGAAGCC A. The nucleotide sequence above is a STR of how many repeats? B. What sequence is being repeated?

Q: a. What are the purposes of sequence alignment?

A: Sequence alignment is a method by which one can arrange sequences of DNA, RNA and protein so as to…

Q: Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA…

A: Cystic fibrosis is a hereditary disease, inherited in an autosomal recessive manner. The cystic…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: 5. 2) Digestion of a 1.1kb fragment of plasmid DNA with BamHl produces two fragments of 700 bp and…

A: BamHI is a type II restriction endonuclease can identify specific restriction site and induce cut on…

Q: With regards to this sequence below please answer this quistions 1) What is the format of the…

A: answer given below

Q: 7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: What is Simple sequence repeat?

A: The genome of every individual contains millions of genetic variation or variants which make each…

Q: Design 6 bp primers to amplify the region of this sequence that is highlighted in yellow. 1…

A: Primers:  Short nucleotide sequences usually 6-10 bp in size that acts as the initiation point for…

Q: Question 4 4. Carrots are the main dietary source of lycopene for American men. True False Question…

A:

Q: Drawbacks of biotechnology in bullets point.

A: Biotechnology is the branch of biology that aims at developing products useful for mankind by using…

Q: The sequence below (A) was read from the autoradiogram (B). (A) 5'…

A: Note: since you have asked multiple unrelated questions, as per the honor code we are answering the…

Q: Transposons are useful as mutagens because they act asmolecular tags for genomic DNA sequences that…

A: Step 1 Transposons or jumping gene is a DNA (deoxyribonucleic acid) sequence that can change its…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Your PhD thesis advisor has given you the task of preparing a human genomic DNA library.  3a. How…

A: The length of the human genome is approximately 3.2 billion bases with genes of 20000-25000 protein…

Q: Obtain the self-dotplot of the following sequence to identify repeat region:…

A: There are various alignment tools available at EMBOSS. It is studied under the domain of…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: 19. For this question, you will need to use the table for the genetic codes provided on the…

A: From DNA , mRNA is formed and use DNA strand as a template. Produced mRNA goes to cytosol and…

Q: B. Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a…

A: A silent mutation is a type of mutation that occurs in DNA where a single nucleotide is changed, but…

Q: 8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: Mutation can be defined as change in nucleotide sequence of a gene. Based on the type of change,…

Q: following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA…

A: A) The output from the given nucleotide sequence is RYIF which is Arginine>Tyrosine>…

Q: Be sure to answer all parts. Consider the following mRNA sequence: 5'-GCU AGG CGA-3'. a. What amino…

A: Translation is the process in which the m rna is converted into a polypeptide chain of amino acids…

Q: Okazaki fragments in bacterial cells are 1000–2000 nucleotides in length. Those in eukaryotic cells…

A: In the bacterial cell, the length of the Okazaki fragment is 1000-2000 nucleotides, while in…

Q: 4. The bars in the following sequence indicate the break 5'-CGGGTAТСТАСТААА| TTCGCACTТАCGAGGAТТААСАТ…

A: Introduction : Primers are small, chemically synthesised oligonucleotides that are complementary to…

Q: Ise Describe ONE way that the use of rodenticides affects the kit fox population AND explain how the…

A: The San Joaquin kit fox is of great importance because it is one of the most endangered animals in…

Q: What is the length in basepairs of these sequences? How many base substitutions are there between…

A: The multiple sequence alignment (MSA) involves the alignment of three or greater than three…

Q: How many base substitutions are there between these sequences? Count ONLY the instances where there…

A: Sequence alignment involves the comparison of sequences of a particular gene from various organisms…

Q: 6). What is the relationship (if any) between the following strand and the strands shown in sections…

A: DNA-Deoxyribonucleic acid  is a molecule that contains genetic information for the development for…

Q: Based on these sequences. Remove codons 24 to 66, inclusive. Sequence A…

A: The enzyme complex responsible for this excision is known as splicesome. Splicesomes are complicated…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…

A: DNA replication is a phenomenon in which DNA make itself using Enzyme DNA Polymerase . It occurs in…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.