Chapter 9, Problem 11P

Consider translation of the following mRNA sequence:

$\text{5'-…AUGCAGAUCCAUGCCUAUUGA…-3'}$

Diagram translation at the moment the fourth amino acid is added to the polypeptide chain. Show the ribosome; label its $\text{A}$, $\text{P}$, and $\text{E}$ sites; show its direction of movement; and indicate the position and anticodon triplet sequence of $\text{tRNAs}$ that are currently interacting with $\text{mRNA}$ codons.

What is the anticodon triplet sequence of the next $\text{tRNA}$ to interact with $\text{mRNA}$?

What events occur to permit the next $\text{tRNA}$ to interact with $\text{mRNA}$?