Genetic Analysis: An Integrated Approach (3rd Edition)
Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
Question
Book Icon
Chapter 9, Problem 28P
Summary Introduction

To analyze:

Several examples of the Shine-Dalgarno sequence are present in Figure 9.7. Using the seven Shine-Dalgarno sequences from E.Coli, identify the consensus sequences and describe its location relative to the start codon.

Introduction:

Consensus sequences are a short stretch of DNA sequences that are commonly located nucleotides found at a specific location of DNA and RNA or amino acids. These sequences are used for inter or intramolecular interactions. These sequences are similar in structure and functions in all organisms.

Genetic Analysis: An Integrated Approach (3rd Edition), Chapter 9, Problem 28P

Blurred answer
Students have asked these similar questions
An mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case.  What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’
A series of tRNAs have the following anticodons. Consider the wobble rules listed in Table  and give all possible codons with which each tRNA can pair. Q. 5′ –AAG–3′
Consider the tryptophan codon 5′ - UGG - 3′ in the standard genetic code . Can a single base change in this codon create a synonymous mutation? Can a single base change in this codon create a nonsense codon?

Chapter 9 Solutions

Genetic Analysis: An Integrated Approach (3rd Edition)

Knowledge Booster
Background pattern image
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning